Table 1.
Primers for amplification and sequence analyses of genes encoding the four shifted proteins found in rifampicin resistant meningococci
| Primer | Sequence (5'→3') | Protein encoded (Locus tag) |
|---|---|---|
| ADZ-f | 576170GCGTTTCAGACGGCATTTGT576189* | putative zinc-binding alcohol dehydrogenase (NMC0547) |
| ADZ-r | 577320GCCAGATTCAGACGGTATTCC577300* | |
| ICD-f | 893762ACGACGAATGTTCAGACGG893780* | isocitrate dehydrogenase (NMC0897) |
| ICD-r | 896097TGCCATAATAGCCACGCAC896079* | |
| PTA-f | 607259AAGCCGTTTGTCAGCCTT 607276* | putative phosphate acyltransferase Pta (NMC0575) |
| PTA-r | 608401CGGGCGTATTGGAAGGTTT 608383* | |
| POX-f | 445746AAAGCCGGATAAGTGGGAAC445765* | putative oxidoreductase (NMC0426) |
* the position referring to the corresponding accession number of N. meningitidis strain FAM18, accession number AM421808.