Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for isoform-specific RT-PCR of CCDC88C
| Primer forward | Sequence | Primer reverse | Sequence |
|---|---|---|---|
| RT_IF1f | aaagccaggcagatcaagg | RT_IF1r | aggcgctctgacttcttgc |
| RT_IF2f | gccaggatgtccgtactaagc | RT_IF2r | cgaggcaaggggtactcg |
| RT_IF3af | cagcctcatttctcaatgtcc | RT IF3ar | tgcttgaaggcatgaagagg |
| RT_IF3bf | ctgctgccctgcttctagg | RT_IF3br | tgctggatgtgtttctactgc |
| RT_IF3f | ctacagccccttccaactcc | RT_IF3r | ctggggatcaggtcttcg |
| RT_IF4nf | ggacggcatctttttgaacc | RT_IF4nr | aatgcagacactcccagacc |
