Strains |
|
|
E. coli
|
|
|
DH5α |
F− φ80 δlacZ ΔM15 endA1 recA1 hsdR17 supE44 thi-1 relA1 Δ(lacZYA-argF) gyrA96 deoR
|
GIBCO-BRL |
P. aeruginosa
|
|
|
PAK |
Wild-type clinical isolate |
David Bradley |
PAK1-3 |
A spontaneous mutant derivative of PAK, Neor
|
31 |
PAK(aph) |
PAK with aph mutated by gentamicin cassette insertion |
This study |
PAK(hpaA) |
PAK with hpaA mutated by Ω insertion |
This study |
Plasmids |
|
|
pUCP19 |
Broad-host-range plasmid, Cbr
|
32 |
pWC001 |
2-kb DNA containing aph insert cloned into pUCP19 |
This study |
pEx18Tc |
Sucrose selection suicide delivery plasmid, Tcr
|
10 |
pExaph |
pEx18Tc containing 1.7-kb BamHI fragment from pWC001 |
This study |
pExaphG |
pExaph with gentamicin cassette inserted at NsiI site disrupting aph gene |
This study |
pDN19lacΩ |
A lacZ fusion plasmid vector, IncP, Spr/Smr/Tcr
|
30 |
pCR2.1-TOPO |
TA-cloning vector, Apr Kmr
|
Invitrogen |
pWC003 |
1.5-kb PCR product (HpaA5-Aph3) of hpaA cloned into pCR2.1-TOPO |
This study |
pWC011 |
pDN19lacΩ containing 1.6-kb fragment from pWC003, aph::lacZ fusion |
This study |
pWC012 |
pDN19lacΩ containing 1.1-kb fragment from pWC003, hpaA::lacZ fusion |
This study |
pWC013 |
pDN19lacΩ containing 1.6-kb fragment from pWC003, PA4121::lacZ fusion with intact hpaA
|
This study |
pWW001 |
1.0-kb PCR product (Aph5-Aph3) of aph cloned into pCR2.1-TOPO |
This study |
pWC014 |
pDN19lac14 containing 1.1-kb fragment from pWW001, aph::lacZ fusion |
This study |
pWC018 |
PA4121::lacZ fusion, without hpaA
|
This study |
pEx18Ap |
Sucrose selection suicide delivery plasmid, Apr
|
10 |
pExhpaA |
pEx18Ap containing XbaI/SacI fragment from pWC003 |
This study |
pWC021 |
pExhpaA with its BglII fragment replaced by Ω insertion |
This study |
Primers |
|
|
HpaA5 |
5′ CGTTGACGATCACGTAGCCGGCGACAT 3′ |
|
Aph5 |
5′ GAGCGCCAGCCGATCCCCAACATCAAC 3′ |
|
Aph3 |
5′ CTCGCCAGCGGTAGCCGGCAAGGTAGT 3′ |
|