Table 1.

Synthetic oligonucleotides used in the assembly of half-site and full-site substrates for Cre reactions are listed

Oligomer	Size (bases)	Sequence
MeP-half-site (top strand)	27	5′ ACTTGGATCCATAACTTCGTATAA(mp)TGT 3′
P-half-site (top strand)	27	5′ ACTTGGATCCATAACTTCGTATAATGT 3′
P- or MeP-half-site (bottom strand); hydrolysis assays	30	5′ CATACATTATACGAAGTTATGGATCCAAGT 3′
P- or MeP-half-site (bottom strand); strand joining assays	39	5′ TGTATGTTTCATACATTATACGAAGTTATGGATCC AAGT 3′
Template oligo used to synthesize the 54-mer strand (top and bottom) of the short MeP-full-site by Klenow polymerase fill-in reaction	45	5′ ACTTGGATCCATAACTTCGTATAATGTACATTATAC GAAGTTAT(ddC) 3′
Template oligo used to synthesize the 70-mer strand (top and bottom) of the long MeP-full-site by Klenow polymerase fill-in reaction	61	5′ GCATGCATGCATGCATACTTGGATCCATAACTTCGT ATAATGTACATTATACGAAGTTAT(ddC) 3′
47-mer used to generate a 74-mer strand (top and bottom) of a long MeP-full-site by ligation to the 27-mer shown in row1	47	5′ ACATTATACGAAGTTATGGATCCAAGTATGCATGCA TGCATGCATGC 3′
splint oligo used in the ligation to generate the 74-mer strand of the long MeP-full-site	44	5′ GATCCATAACTTCGTATAATGTACATTATACGAAGT TATGGATC 3′

The string of nucleotides shown in bold represents the Cre binding element. The scissile phosphate or methylphosphonate is indicated by ‘p’ or ‘mp’, respectively. The template oligos employed in the Klenow polymerase reactions contained a 3′-terminal dideoxy-C (ddC).