Skip to main content
PLOS One logoLink to PLOS One
. 2010 Oct 28;5(10):e15387. doi: 10.1371/journal.pone.0015387

MRE11 Function in Response to Topoisomerase Poisons Is Independent of its Function in Double-Strand Break Repair in Saccharomyces cerevisiae

Nicolle K Hamilton 1, Nancy Maizels 1,2,*
Editor: Michael Lichten3
PMCID: PMC2965672  PMID: 21060845

Abstract

Camptothecin (CPT) and etoposide (ETP) trap topoisomerase-DNA covalent intermediates, resulting in formation of DNA damage that can be cytotoxic if unrepaired. CPT and ETP are prototypes for molecules widely used in chemotherapy of cancer, so defining the mechanisms for repair of damage induced by treatment with these compounds is of great interest. In S. cerevisiae, deficiency in MRE11, which encodes a highly conserved factor, greatly enhances sensitivity to treatment with CPT or ETP. This has been thought to reflect the importance of double-strand break (DSB) repair pathways in the response to these to agents. Here we report that an S. cerevisiae strain expressing the mre11-H59A allele, mutant at a conserved active site histidine, is sensitive to hydroxyurea and also to ionizing radiation, which induces DSBs, but not to CPT or ETP. We show that TDP1, which encodes a tyrosyl-DNA phosphodiesterase activity able to release both 5′- and 3′-covalent topoisomerase-DNA complexes in vitro, contributes to ETP-resistance but not CPT-resistance in the mre11-H59A background. We further show that CPT- and ETP-resistance mediated by MRE11 is independent of SAE2, and thus independent of the coordinated functions of MRE11 and SAE2 in homology-directed repair and removal of Spo11 from DNA ends in meiosis. These results identify a function for MRE11 in the response to topoisomerase poisons that is distinct from its functions in DSB repair or meiotic DNA processing. They also establish that cellular proficiency in repair of DSBs may not correlate with resistance to topoisomerase poisons, a finding with potential implications for stratification of tumors with specific DNA repair deficiencies for treatment with these compounds.

Introduction

Topoisomerase poisons are potent drugs for treatment of cancer. Two naturally occurring topoisomerase inhibitors, camptothecin (CPT) and etoposide (ETP), are prototypes for this class of chemotherapeutics, which target Topoisomerase I (Topo I) and Topoisomerase II (Topo II) respectively. Topo I regulates DNA superhelicity ahead of transcription and replication forks by inserting itself into one strand of the DNA backbone, forming a 3′-covalent bond between a tyrosine residue on the enzyme and the nicked DNA strand and enabling rotation of the intact strand around the nick. CPT binds at the single-strand break 3′ of the Topo I-DNA complex, stabilizing the covalent Topo I-DNA intermediate and inhibiting religation of the DNA nick. Topo II promotes decatenation of DNA following replication, inserting into both strands of the duplex to form a double-strand break (DSB), with 5′-DNA ends tethered to tyrosine residues on Topo II subunits, enabling intact DNA to pass through the DSB. ETP intercalates at Topo II insertion sites, stabilizing the DSB intermediate. Defining the mechanisms of repair of damage induced by CPT and ETP is of considerable practical importance, because both are potent cytotoxic agents and their derivatives are commonly used in cancer chemotherapy.

Mutants of S. cerevisiae deficient in MRE11 (mre11Δ) are very sensitive to CPT [1], [2], [3] and to ETP [4]. MRE11 encodes a multifunctional nuclease, active as a 3′-5′ dsDNA exonuclease, a single-strand DNA endonuclease and an AP lyase in vitro, and shown to function in DNA repair, meiotic recombination, telomere maintenance and immunoglobulin gene diversification [5], [6], [7], [8], [9], [10], [11]. Its mechanism of function in response to CPT or ETP is not understood, but has been thought to correlate with activity in DSB repair, which is dependent upon its 3′-5′ exonuclease activity.

Here we describe a new S. cerevisiae mutant allele, mre11-H59A. We show that an S. cerevisiae mre11-H59A strain is as sensitive to HU and IR as the well-characterized DSB repair-deficient mre11-H125N strain [3], [10], [12], [13]. However, in contrast to the mre11-H125N strain, the mre11-H59A strain is resistant to CPT. CPT-resistance does not depend upon TDP1, which encodes a factor that releases covalent 3′- or 5′-tyrosyl DNA bonds in vitro [14], [15], [16], [17]. The mre11-H59A and mre11-H125N strains are both resistant to ETP, which is toxic to the mre11Δ strain; but deficiency in TDP1 (tdp1Δ) causes these strains to become ETP-sensitive. Neither CPT- nor ETP-resistance of the mre11-H59A strain depends upon SAE2, which is required for MRE11-dependent removal of Spo11 from the ends of meiotic DNA [18] and regulates functions of MRE11 in homologous recombination [19]. Thus MRE11 has distinct functions in repair of damage induced by topoisomerase poisons and repair of mitotic and meiotic DSBs.

Results

S. cerevisiae mre11-H59A Is Sensitive to Hydroxyurea but Not CPT

To distinguish functions of MRE11 in DSB repair and response to DNA damage by topoisomerase poisons, two previous findings drew our attention to the conserved active site histidine at residue 59 (H59) in phosphodiesterase motif II of S. cerevisiae Mre11 (Fig. 1A). Biochemical analysis had shown that purified recombinant Pyrococcus furiosus Mre11 with a mutation at this site (H52S) is deficient in exonuclease activity; while genetic analysis had shown that mutation at the corresponding position of the Schizosaccharomyces pombe Mre11 homologue (rad32-H68S) did not render cells sensitive to CPT, HU or IR [8].

Figure 1. The mre11-H59A allele confers sensitivity to HU but not CPT.

Figure 1

A. Conserved phosphodiesterase motifs in the active site of the Mre11 protein. Sequences of conserved amino acid residues in Motifs I–V are shown for three different organisms: S. cerevisiae (Sc), S. pombe (Sp), and Homo sapiens (Hs). Effects of mutations at S. cerevisiae residues shown in red in were tested in experiments described herein. The lengths of the Mre11 polypeptides are all different, and positions of the conserved residues in each motif are shown below for reference: Sc, I, H18; II, D56, H59; III, H125; IV, H213; V, H241, H243; Sp, I, H13; II, D65, H68; III, H134; IV, H222; V, H250, H252; Hs, I, H22; II, D60, H63; III, H129; IV, H217; V, H245, H247. B. Serial spot dilution assays of sensitivity to HU and CPT of S. cerevisiae wild-type parental line Jel1 (Jel1); or its MRE11-deficient derivative, Jel1 mre11Δ, stably transformed with 2 µ plasmid vectors expressing protein as indicated, including empty vector (Jel1 mre11Δ +2 µ), wild-type MRE11 (+2 µ MRE11), or indicated mutant alleles (+2 µ mre11-D56A, +2 µ mre11-D56N, +2 µ mre11-H59A, +2 µ mre11-H125N, +2 µ mre11-H213Y). Cells were spotted at 10-fold serial dilutions (indicated by triangles) on rich plates containing no drug (left) or indicated concentrations of HU or CPT. C. Clonogenic survival assays of sensitivity to HU and CPT. Strains were assayed for colony formation at indicated doses of each compound. Survival was normalized to untreated samples; error bars indicate standard error of the mean.

In order to study the effect of mutation of H59 in S. cerevisiae and compare this allele to well-characterized mutant alleles, we generated a panel of strains bearing mutations in conserved residues in the Mre11 active site phosphodiesterase motifs (Fig. 1A). S. cerevisiae Jel1 mre11Δ (LSY1706, MATα leu2 trp1 ura3-52 prb1-1122 pep4-3 his3::GAL10-GAL4 mre11::His3MX6; [12]) was stably transformed with pYES 2 µ vectors expressing C-terminal TAP-tagged Mre11 or mutant Mre11-H59A, Mre11-D56A, Mre11-D56N, Mre11-H125N or Mre11-H213Y under control of the GAL1 promoter, and gene and protein expression were confirmed by RT-PCR (not shown) and western blotting (Fig. S1). Mutations at D56 alter a conserved glutamate in close proximity to H59 in phosphodiesterase motif II (Fig. 1A), known to be important for resistance to HU and IR [12]. Mutation of H125 alters a residue in phosphodiesterase motif III that is invariant among species and necessary for stabilizing the transition state during nucleolysis [8], [20], [21]. S. cerevisiae mre11-H125N mutants have previously been shown to be sensitive to DNA damaging agents including CPT and IR [3], [10], [12], [13]; and a corresponding S. pombe active site mutant (rad32-H134S) is associated with both CPT-sensitivity and IR-sensitivity [8]. The mre11-H213Y allele, one of the first MRE11 mutants studied, alters an invariant histidine in motif IV. It causes deficiency in both meiotic and mitotic DSB repair [22], and the corresponding mutant Mre11 protein fails to form a stable complex with Rad50 [12], [23], [24].

Sensitivity to HU and CPT was determined by spot dilution assays. Serial 10-fold dilutions of an overnight culture of each strain were spotted onto YPD plates containing various concentrations of HU or CPT. The Jel1 mre11Δ strain and its derivative expressing mre11-H213Y were extremely sensitive to HU; the derivatives expressing mre11-H59A and mre11-H125N were no more sensitive than the derivative expressing MRE11; and the derivatives expressing mre11-D56A and mre11-D56N were relatively resistant (Fig. 1B, left). Spot tests also showed that Jel1 mre11Δ and its derivative expressing mre11-H213Y were extremely sensitive to CPT, the derivatives expressing mre11-D56A, mre11-D56N and mre11-H125N slightly less sensitive, and the derivative expressing mre11-H59A relatively resistant, although slightly less so than the derivative expressing MRE11 (Fig. 1B, right). Identical results were obtained using the low copy number CEN plasmid p416ADH expressing MRE11, mre11-H59A or mre11-H213Y alleles (data not shown). Thus, the mre11-H59A mutation caused sensitivity to HU but not to CPT, as measured by spot dilution assays.

The contrasting effects of the mre11-H59A mutation on HU and CPT sensitivity were confirmed by clonogenic survival assays. These assays showed that the strain expressing mre11-H59A was sensitive to HU, less so than the extremely HU-sensitive Jel1 mre11Δ strain or its derivative expressing mre11-H213Y, but more sensitive than the parental Jel1 strain or the Jel1 mre11Δ derivatives expressing MRE11, mre11-D56A, mre11-D56N or mre11-H125N (Fig. 1C, left). Nonetheless, the Jel1 mre11Δ derivative expressing mre11-H59A was as resistant to CPT as the Jel1 parental line or the Jel1 mre11Δ derivative expressing MRE11 (Fig. 1C, right).

The S. cerevisiae mre11-H59A Strain Exhibits Intermediate Sensitivity to IR

To test sensitivity to IR, we focused on a panel of six strains, exposed cells in liquid culture to radioactive cesium, plated aliquots in triplicate, determined colony number after 3–4 days growth and normalized to the unexposed samples. The mre11-H59A strain was of intermediate sensitivity to IR, less resistant than the Jel1 parental strain or the Jel1 mre11Δ derivative expressing MRE11, but comparable to the derivatives expressing mre11-D56N, mre11-D56A or mre11-H125N, and more resistant than Jel1 mre11Δ or its derivative expressing mre11-H213Y (Fig. 2).

Figure 2. The mre11-H59A allele confers sensitivity to IR.

Figure 2

Cell survival was measured following indicated exposure to radioactive 137Cs, and normalized to unirradiated samples. Error bars indicate standard error of the mean. Strain notations as in Fig. 1.

TDP1 Does Not Contribute to CPT-Resistance of MRE11-Deficient Strains

The enzyme Tyrosyl-DNA-phosphodiesterase 1 (Tdp1) was identified as an activity in S. cerevisiae extracts capable of removing a trapped Topo I-DNA complex in vitro [14]. However, S. cerevisiae tdp1Δ mutants exhibit only minor increases in sensitivity to CPT, either in strains expressing MRE11 or in the MRE11-deficient strains tested thus far, including mre11-H125N [1], [3], [17], [25]. To compare function of TDP1 and MRE11 in CPT resistance, we created Jel1 tdp1Δ and Jel1 mre11Δ tdp1Δ derivatives, and transformed the latter with 2 µ plasmids expressing MRE11 or mre11-H59A, mre11-H125N and mre11-H213Y mutant alleles. In spot dilution assays, the Jel1 mre11Δ strain was much more severely CPT-sensitive than the Jel1 tdp1Δ strain, and sensitivity was not enhanced in the Jel1 mre11Δ tdp1Δ double mutant (Fig. 3). Moreover, the Jel1 tdp1Δ mre11Δ derivatives expressing MRE11, mre11-H59A, mre11-H125N or mre11-H213Y exhibited CPT-sensitivity essentially indistinguishable from the corresponding Jel1 mre11Δ derivatives (Fig. 3, compare lower and upper). Thus, MRE11 was more critical to CPT-resistance than TDP1, and deficiency in TDP1 did not affect CPT sensitivity of MRE11-deficient strains.

Figure 3. TDP1 does not contribute to CPT-resistance of MRE11-deficient strains.

Figure 3

Serial spot dilution assays of sensitivity to CPT of S. cerevisiae Jel1 TDP1 or Jel1 TDP1 mre11Δ (above), and Jel1 tdp1Δ or Jel1 tdp1Δ mre11Δ (below). The mre11Δ derivatives were stably transformed with 2 µ plasmid vectors, including empty vector (Jel1 mre11Δ +2 µ) or vectors expressing wild-type MRE11 (Jel1 mre11Δ +2 µ MRE11) or indicated mutant alleles (+2 µ mre11-H59A, +2 µ mre11-H125N, +2 µ mre11-H213Y). Cells were spotted at 10-fold serial dilutions on rich plates containing no drug (left) or indicated concentrations of CPT.

TDP1 Contributes to ETP-Resistance of mre11-H59A and mre11-H125N Mutants

In S. cerevisiae, MRE11-deficiency causes sensitivity to ETP, which traps covalent complexes formed by Topo II with DNA 5′-ends [4]. We therefore tested ETP sensitivity of a panel of MRE11-deficient strains in a spot dilution assay. We found that the Jel1 mre11Δ strain and its derivative expressing mre11-H213Y were extremely sensitive to ETP, while derivatives expressing mre11-H59A or mre11-H125N were as resistant as Jel1 or the Jel1 mre11Δ derivative expressing MRE11 (Fig. 4, above). Thus, expression of mre11-H59A conferred resistant to ETP and CPT, despite marked sensitivity to HU and IR; and expression of mre11-H125N strain conferred resistant to ETP, despite sensitivity to CPT, HU and IR.

Figure 4. TDP1 contributes to ETP-resistance of mre11-H59A and mre11-H125N strains.

Figure 4

Serial spot dilution assays of sensitivity to ETP of indicated S. cerevisiae derivatives of parental line Jel1; notations as in Fig. 3. Cells were spotted at 10-fold serial dilutions on rich plates containing no drug (left) or indicated concentrations of ETP.

Tdp1 can remove not only Topo I-3′-DNA covalent complexes in vitro, but also Topo II-5′-DNA covalent complexes [17]. We therefore asked how ETP-resistance was affected by deficiencies in TDP1 and MRE11. In spot dilution assays, Jel1 and Jel1 tdp1Δ were comparably ETP-sensitive, while the Jel1 mre11Δ strain was much more severely ETP-sensitive than the Jel1 tdp1Δ strain (Fig. 4, compare lower and upper). Thus, deficiency in MRE11 caused much more severe ETP-sensitivity than deficiency in TDP1. Moreover, while deficiency in TDP1 did not affect ETP-sensitivity of the Jel1 mre11Δ derivative expressing MRE11, it did cause a modest increase in ETP-sensitivity of the Jel1 mre11Δ derivative expressing mre11-H59A, and a more severe increase in sensitivity of the derivative expressing mre11-H125N (Fig. 4, lower).

SAE2 Makes a Modest Contribution to CPT- or ETP-Resistance

SAE2 encodes a repair endonuclease that is essential for Mre11 function in removal of Spo11 from 5′-ends of DNA in meiosis, and that regulates activities of Mre11 in homologous recombination [18], [19], [26]. Deficiency in SAE2 has been reported not to affect CPT- or ETP-sensitivity in S. cerevisiae [3], [18], although the SAE2 ortholog, CtIP, is essential for CPT-resistance in S. pombe [27]. Because of the role of SAE2 in meiosis, it seemed important to test the effect of deficiency in SAE2 on CPT- and ETP-sensitivity of the Jel1 mre11Δ derivative expressing mre11-H59A. We therefore generated Jel1 sae2Δ and Jel1 sae2Δ mre11Δ strains, and Jel1 sae2Δ mre11Δ derivatives expressing MRE11, mre11-H59A or mre11-H213Y alleles (the latter was included as a control due to its severe meiotic defect). Consistent with the role of SAE2 in DSB repair, strains deficient in SAE2, including Jel1 sae2Δ, Jel1 sae2Δ mre11Δ, and derivatives of the latter expressing MRE11, mre11-H59A, or mre11-H213Y, all exhibited greater HU sensitivity than the parental SAE2 strains (Fig. 5A). However, deficiency in SAE2 caused only a very modest increase in CPT-sensitivity (Fig. 5B) or ETP-sensitivity (Fig. 5C). Thus, SAE2 is not critical to MRE11-dependent repair of damage induced by CPT or ETP.

Figure 5. SAE2 contributes to HU-resistance, but not CPT- or ETP-resistance.

Figure 5

A. Serial spot dilution assay of HU sensitivity of S. cerevisiae parental line Jel1; or its mre11Δ and sae2Δmre11Δ derivatives stably transformed with 2 µ plasmid vectors, including empty vector (Jel1 mre11Δ +2 µ) or vectors expressing wild-type MRE11 (Jel1 mre11Δ +2 µ MRE11) or indicated mutant alleles (+2 µ mre11-H59A, +2 µ mre11-H213Y). B. Serial spot dilution assay of CPT sensitivity of the strains described in panel A. C. Serial spot dilution assay of ETP sensitivity of the strains described in panel A.

Discussion

We have shown that the S. cerevisiae mre11-H59A strain is resistant to topoiosomerase poisons CPT and ETP, which create protein-DNA covalent complexes; but sensitive to HU and sensitive to IR, which induces DSBs. These results establish that the MRE11 function in DSB repair can be separated from its function in repair of CPT- or ETP-induced DNA damage. They also establish that a cell need not be proficient in repair of DSBs to resist topoisomerase poisons.

Our results identify several clear distinctions between S. cerevisiae and S. pombe in the response to topoisomerase poisons. One difference is in functions associated with specific residues of the highly conserved active site of the Mre11 polypeptide. The S. cerevisiae mre11-H59A strain that we have studied carries a mutation at a conserved active site histidine in phosphodiesterase motif II of the active site and is resistant to CPT but sensitive to HU and IR. An S. pombe strain carrying a mutation at the corresponding position, rad32(mre11)-H68S, is resistant to CPT and also to HU and IR [8].

The repair pathways for CPT- and ETP-induced damage in S. cerevisiae and S. pombe also exhibit distinct dependence upon other factors. In S. cerevisiae, TDP1-deficiency has little effect on CPT-sensitivity, either in strains expressing wild-type MRE11 [1], [25] or in the four mre11 mutant strains we examined. This contrasts with S. pombe, where TDP1-deficiency has a pronounced effect on CPT-sensitivity [28]. In S. cerevisiae, SAE2 makes only a very modest contribution to CPT- or ETP-resistance. This also contrasts with S. pombe, where deficiency in the SAE2 ortholog, CtIP, impairs the ETP response, but surprisingly promotes the CPT response [27].

How might MRE11 function to prevent toxicity by topoisomerase poisons independent of DSB repair? A critical step that distinguishes the response to topoisomerase poisons from other cytotoxic treatments is removal of the covalent protein-DNA complexes that accumulate in cells treated with these compounds. Our results raise the possibility that MRE11 may promote cleavage of tyrosyl-DNA bonds, either directly or indirectly. Several factors possess this activity, including the conserved enzyme Tdp1, which can cleave both 3′- and 5′-covalent tyrosyl-DNA bonds in vitro [14], [15], [16], [17]; the structure-specific nucleases Rad1/Rad10 and Mms4/Mus81, which appear to function redundantly with Tdp1 in release of 3′-covalent protein DNA complexes in vivo [29]; and the recently discovered human factor, Tdp2, which can cleave 5′-tyrosyl-DNA covalent bonds in vitro and rescue CPT-sensitivity of S. cerevisiae tdp1Δ rad1Δ mutants in vivo [30]. Consistent with a role for MRE11 in promoting cleavage of tyrosyl-DNA covalent bonds, topoisomerase-DNA complexes have been shown to persist in an S. pombe rad32(mre11)-D65N strain following treatment with CPT or ETP [27].

Determining the mechanism of MRE11 function in the response to topoisomerase poisons has important implications for the clinical setting. A subset of human colorectal cancers is MRE11-deficient [31], [32]. If MRE11 functions to promote release of covalent topoisomerase-DNA complexes independent of its role in DSB repair, MRE11-deficient tumors may be priority candidates for treatment with CPT and ETP derivatives. This could have implications for stratification of tumors with specific DNA repair deficiencies for treatment with topoisomerase poisons.

Materials and Methods

S. cerevisiae Strains

Strains were derived from Jel1 (Matα leu2 trp1 ura3-52 prbl-1122 pep4-3 his3::pGAL10-GAL4) or Jel1 mre11Δ (Matα leu2 trp1 ura3-52 prbl-1122 pep4-3 his3::pGAL10-GAL4 mre11::HIS3), kindly provided by Dr. Lorraine Symington, Columbia University [12]. The tdp1Δ and sae2Δ derivatives were constructed using the PCR method of gene deletion [33], which replaces the target gene by a G418 resistance marker. G418-resistance markers were amplified from S. cerevisiae tdp1Δ and sae2Δ strains, kindly provided by Dr. Stanley Fields (University of Washington). Primers, designed to provide homology arms of about 500 bp, were:

SAE2 F: 5′-CAGTAATTGACGATGCGGAAGG

SAE2 R: 5′-CGACGTTCTCTATCATAATAAAACCCTGG

TDP1 F: 5′-CAGCATTTTTATGTTCAGTAATCATTGAACTTG

TDP1 R: 5′-GGAGCATCTATTAAAAAGAGCTTTTAATC

PCR products were purified and transformed into Jel1 or mre11Δ strains using the lithium acetate method. Integrants were selected on either CSM-URA or YPD plates containing 200 µg/ml G418, and deletion verified by sequencing the products of colony PCR.

MRE11 Expression Constructs

MRE11 was PCR-amplified from Jel1, using PCR primers 5′-CGGGGTACCATGGTGCATCATCAC and 5′-CTAGTCTAGATTTTCTTTTCTTAGCAAGGAGACTTCCAAGAATATCCG, which modified the gene to create a KpnI site and consensus translation initiation sequence at the 5′ end and remove the stop codon and create an XbaI site at the 3′ end (KpnI and XbaI sites underlined). DNA was digested with KpnI and XbaI and inserted into the KpnI and XbaI sites of a 2 µ pYES2 plasmid carrying the URA3 selectable marker (Invitrogen, Carlsbad, CA). A TAP tag was amplified from a construct provided by Dr. Trisha Davis (University of Washington), using primers 5′-CTAGTCTAGAATGAAGCGACGATGGAAAAAGAATTTCATAGCCG and 5′-CTAGTCTAGATTATTCTTTGTTGAATTTGTTATCCGCTTTCGGTGCTTGAG to create XbaI sites (underlined) on both 5′ and 3′ ends, XbaI-digested and inserted into the XbaI-digested pYES2-MRE11 construct, and screened for directional insertion, generating pYES2-MRE11-TAP. MRE11 was expressed from the GAL1 promoter in these plasmids. Mutants were generated by QuikChange (Stratagene, La Jolla, CA) and verified by sequencing, using the following primers and their complements (mutations underlined):

D56A: 5′-ATGGTTGTACAGTCCGGTGCTCTTTTTCACGTGAATAAG

D56N: 5′-ACATGGTTGTACAGTCCGGTAATCTTTTTCACGTGAATAAG

H59A: 5′-GTTGTACAGTCCGGTGATCTTTTTGCCGTGAATAAGCCTTC

H125N: 5′-TATTCGGCATATCAGGTAATAATGATGATGCGTCGGG

H213Y: 5′-GGTTTAATTTAATGTGCGTCTATCAAAATCATACAGGTCACAC

Western Blotting

Approximately 5×108 cells were pelleted, resuspended in 500 µl lysis buffer (25 mM Tris-HCl pH 7.5, 1 mM EDTA, 0.5% NP-40, 10% glycerol, 1 mM PMSF, 1 mM DTT, 150 mM NaCl, 1xRoche Complete Protease Inhibitor), then lysed by vortexing with 500 µl glass beads at full speed 5×1 min, incubating at least 1 min on ice between vortexing. Following SDS-PAGE electrophoresis and transfer, blots were probed using polyclonal anti-ScMre11 (GeneTex) at 1∶2000 and anti-β-actin (Abcam) at 1∶2000.

HU, CPT, ETP and IR Sensitivity Assays

Published procedures were used to assay sensitivity to HU [12], CPT [1], IR [12], and ETP [4]. In brief, spot dilution assays were performed by plating 3 µl of serial 10-fold dilutions of a liquid culture, containing from 103–106 cells/ml, on YPD plates with or without drug. Clonogenic survival assays for CPT-sensitivity were carried out on cells cultured in liquid medium containing 1–20 µM CPT for 6 hr (about 5–8 cell divisions). Aliquots were removed and plated on YPD in triplicate, colonies counted 3–4 days later and percent survival normalized to an untreated control. For HU clonogenic survival assays, cells from liquid culture were plated in triplicate on YPD plates containing various concentrations of HU, colonies counted 3–4 days later and percent survival normalized to an untreated control. Sensitivity to IR was measured by exposing cells in liquid culture to radioactive 137Cs at the indicated dosage, plating on YPD and counting surviving colonies 3–4 days later. A JL-Shepherd Model 81-14 Cesium-137 Irradiator was used for all in vitro radiation treatments in this study. Cell suspensions in 1.5 ml tubes were exposed to 137Cs γ-rays at a dose rate of 3 Gy/min. Dosimetry was performed before every radiation treatment to ensure consistency in the dose rate. For survival curves, representative plots are shown for at least three independent experiments with similar results; error is calculated for triplicates within the experiment; and survival was normalized to untreated controls.

Supporting Information Legends

Figure S1

Expression of Mre11 protein. Western blot analysis of Mre11 protein levels in indicated strains (designated as described in Fig. 1), normalized to β-actin. Mre11 expressed from 2 µ vectors carried a C-terminal TAP-tag, and was therefore slightly larger than the endogenous protein.

(TIF)

Acknowledgments

We thank Vivian McKay for advice; the laboratory of Jeffrey Schwartz for assistance with irradiation studies; and Luther Davis, Amber Caracol and Liz Sacho for especially useful discussions.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: Funding was provided by National Institutes of Health P01 CA77852 to NM; National Institutes of Health T32 GM07270 to NKH. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Liu C, Pouliot JJ, Nash HA. Repair of topoisomerase I covalent complexes in the absence of the tyrosyl-DNA phosphodiesterase Tdp1. Proc Natl Acad Sci U S A. 2002;99:14970–14975. doi: 10.1073/pnas.182557199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Liu C, Pouliot JJ, Nash HA. The role of TDP1 from budding yeast in the repair of DNA damage. DNA Repair (Amst) 2004;3:593–601. doi: 10.1016/j.dnarep.2004.03.030. [DOI] [PubMed] [Google Scholar]
  • 3.Deng C, Brown JA, You D, Brown JM. Multiple endonucleases function to repair covalent topoisomerase I complexes in Saccharomyces cerevisiae. Genetics. 2005;170:591–600. doi: 10.1534/genetics.104.028795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Baldwin EL, Berger AC, Corbett AH, Osheroff N. Mms22p protects Saccharomyces cerevisiae from DNA damage induced by topoisomerase II. Nucleic Acids Res. 2005;33:1021–1030. doi: 10.1093/nar/gki246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hopkins BB, Paull TT. The P. furiosus Mre11/Rad50 complex promotes 5′ strand resection at a DNA double-strand break. Cell. 2008;135:250–260. doi: 10.1016/j.cell.2008.09.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Larson ED, Cummings WJ, Bednarski DW, Maizels N. MRE11/RAD50 cleaves DNA in the AID/UNG-dependent pathway of immunoglobulin gene diversification. Mol Cell. 2005;20:367–375. doi: 10.1016/j.molcel.2005.09.018. [DOI] [PubMed] [Google Scholar]
  • 7.Stracker TH, Petrini JH. Working together and apart: the twisted relationship of the Mre11 complex and Chk2 in apoptosis and tumor suppression. Cell Cycle. 2008;7:3618–3621. doi: 10.4161/cc.7.23.7064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Williams RS, Moncalian G, Williams JS, Yamada Y, Limbo O, et al. Mre11 dimers coordinate DNA end bridging and nuclease processing in double-strand-break repair. Cell. 2008;135:97–109. doi: 10.1016/j.cell.2008.08.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Paull TT, Gellert M. The 3′ to 5′ exonuclease activity of Mre11 facilitates repair of DNA double-strand breaks. Mol Cell. 1998;1:969–979. doi: 10.1016/s1097-2765(00)80097-0. [DOI] [PubMed] [Google Scholar]
  • 10.Lewis LK, Storici F, Van Komen S, Calero S, Sung P, et al. Role of the nuclease activity of Saccharomyces cerevisiae Mre11 in repair of DNA double-strand breaks in mitotic cells. Genetics. 2004;166:1701–1713. doi: 10.1534/genetics.166.4.1701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Trujillo KM, Sung P. DNA structure-specific nuclease activities in the Saccharomyces cerevisiae Rad50/Mre11 complex. J Biol Chem. 2001;276:35458–35464. doi: 10.1074/jbc.M105482200. [DOI] [PubMed] [Google Scholar]
  • 12.Krogh BO, Llorente B, Lam A, Symington LS. Mutations in Mre11 phosphoesterase motif I that impair Saccharomyces cerevisiae Mre11-Rad50-Xrs2 complex stability in addition to nuclease activity. Genetics. 2005;171:1561–1570. doi: 10.1534/genetics.105.049478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Farah JA, Cromie G, Steiner WW, Smith GR. A novel recombination pathway initiated by the Mre11/Rad50/Nbs1 complex eliminates palindromes during meiosis in Schizosaccharomyces pombe. Genetics. 2005;169:1261–1274. doi: 10.1534/genetics.104.037515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yang SW, Burgin AB, Jr, Huizenga BN, Robertson CA, Yao KC, et al. A eukaryotic enzyme that can disjoin dead-end covalent complexes between DNA and type I topoisomerases. Proc Natl Acad Sci U S A. 1996;93:11534–11539. doi: 10.1073/pnas.93.21.11534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Pouliot JJ, Yao KC, Robertson CA, Nash HA. Yeast gene for a Tyr-DNA phosphodiesterase that repairs topoisomerase I complexes. Science. 1999;286:552–555. doi: 10.1126/science.286.5439.552. [DOI] [PubMed] [Google Scholar]
  • 16.Interthal H, Pouliot JJ, Champoux JJ. The tyrosyl-DNA phosphodiesterase Tdp1 is a member of the phospholipase D superfamily. Proc Natl Acad Sci U S A. 2001;98:12009–12014. doi: 10.1073/pnas.211429198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Nitiss KC, Malik M, He X, White SW, Nitiss JL. Tyrosyl-DNA phosphodiesterase (Tdp1) participates in the repair of Top2-mediated DNA damage. Proc Natl Acad Sci U S A. 2006;103:8953–8958. doi: 10.1073/pnas.0603455103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Neale MJ, Pan J, Keeney S. Endonucleolytic processing of covalent protein-linked DNA double-strand breaks. Nature. 2005;436:1053–1057. doi: 10.1038/nature03872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mimitou EP, Symington LS. DNA end resection: many nucleases make light work. DNA Repair (Amst) 2009;8:983–995. doi: 10.1016/j.dnarep.2009.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Arthur LM, Gustausson K, Hopfner KP, Carson CT, Stracker TH, et al. Structural and functional analysis of Mre11-3. Nucleic Acids Res. 2004;32:1886–1893. doi: 10.1093/nar/gkh343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hopfner KP, Karcher A, Craig L, Woo TT, Carney JP, et al. Structural biochemistry and interaction architecture of the DNA double-strand break repair Mre11 nuclease and Rad50-ATPase. Cell. 2001;105:473–485. doi: 10.1016/s0092-8674(01)00335-x. [DOI] [PubMed] [Google Scholar]
  • 22.Tsubouchi H, Ogawa H. A novel mre11 mutation impairs processing of double-strand breaks of DNA during both mitosis and meiosis. Mol Cell Biol. 1998;18:260–268. doi: 10.1128/mcb.18.1.260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chamankhah M, Xiao W. Formation of the yeast Mre11-Rad50-Xrs2 complex is correlated with DNA repair and telomere maintenance. Nucleic Acids Res. 1999;27:2072–2079. doi: 10.1093/nar/27.10.2072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Usui T, Ohta T, Oshiumi H, Tomizawa J, Ogawa H, et al. Complex formation and functional versatility of Mre11 of budding yeast in recombination. Cell. 1998;95:705–716. doi: 10.1016/s0092-8674(00)81640-2. [DOI] [PubMed] [Google Scholar]
  • 25.Pouliot JJ, Robertson CA, Nash HA. Pathways for repair of topoisomerase I covalent complexes in Saccharomyces cerevisiae. Genes Cells. 2001;6:677–687. doi: 10.1046/j.1365-2443.2001.00452.x. [DOI] [PubMed] [Google Scholar]
  • 26.Lengsfeld BM, Rattray AJ, Bhaskara V, Ghirlando R, Paull TT. Sae2 is an endonuclease that processes hairpin DNA cooperatively with the Mre11/Rad50/Xrs2 complex. Mol Cell. 2007;28:638–651. doi: 10.1016/j.molcel.2007.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hartsuiker E, Mizuno K, Molnar M, Kohli J, Ohta K, et al. Ctp1CtIP and Rad32Mre11 nuclease activity are required for Rec12Spo11 removal, but Rec12Spo11 removal is dispensable for other MRN-dependent meiotic functions. Mol Cell Biol. 2009;29:1671–1681. doi: 10.1128/MCB.01182-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ben Hassine S, Arcangioloi B. Tdp1 protects against oxidative DNA damage in non-dividing fission yeast. EMBO J. 2009;28:632–640. doi: 10.1038/emboj.2009.9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Vance JR, Wilson TE. Yeast Tdp1 and Rad1-Rad10 function as redundant pathways for repairing Top1 replicative damage. Proc Natl Acad Sci U S A. 2002;99:13669–13674. doi: 10.1073/pnas.202242599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cortes Ledesma F, El Khamisy SF, Zuma MC, Osborn K, Caldecott KW. A human 5′-tyrosyl DNA phosphodiesterase that repairs topoisomerase-mediated DNA damage. Nature. 2009;461:674–678. doi: 10.1038/nature08444. [DOI] [PubMed] [Google Scholar]
  • 31.Giannini G, Rinaldi C, Ristori E, Ambrosini MI, Cerignoli F, et al. Mutations of an intronic repeat induce impaired MRE11 expression in primary human cancer with microsatellite instability. Oncogene. 2004;23:2640–2647. doi: 10.1038/sj.onc.1207409. [DOI] [PubMed] [Google Scholar]
  • 32.Giannini G, Ristori E, Cerignoli F, Rinaldi C, Zani M, et al. Human MRE11 is inactivated in mismatch repair-deficient cancers. EMBO Rep. 2002;3:248–254. doi: 10.1093/embo-reports/kvf044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Baudin A, Ozier-Kalogeropoulos O, Denouel A, Lacroute F, Cullin C. A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucleic Acids Res. 1993;21:3329–3330. doi: 10.1093/nar/21.14.3329. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Expression of Mre11 protein. Western blot analysis of Mre11 protein levels in indicated strains (designated as described in Fig. 1), normalized to β-actin. Mre11 expressed from 2 µ vectors carried a C-terminal TAP-tag, and was therefore slightly larger than the endogenous protein.

(TIF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES