Table 1. Plasmids.

Plasmid	Proteina	P4 regionb	Vector	Relevant phenotype or construction	Reference
pACYC184				CamR; plac; p15A origin	31
pBR322				AmpR; plac; ColE1 origin	32
pC132c	CI∼Rop		pBR322		26
pC168c	CI∼Rop		pACYC184		27
pC169c	CI*∼Rop		pBR322		27
pEG202d	LexA				21
pGM283	Cnr	6727–7629	pUC19		17
pGM583	α	4595–6969	pGZ119	From pGZα by insertion of an EcoRI site at the 5′ of the α gene
pGM584	Cnr	6984–7304	pGZ119	PCR with 119EcoRI–118SalIe
pGM585	LexA∼α	4636–6969	pEG202	EcoRI–SalI fragment of pGM583
pGM587	LexA∼αcrL733V	4595–6969	pGM585	Substitution of the NotI–SalI fragment derived from pGZαcr4773
pGM588	LexA∼αcrG732W	4595–6969	pGM585	As above, derived from pGZα4776A
pGM589	LexA∼αcrG732V	4595–6969	pGM585	As above, derived from pGZα4775B
pGM590	LexA∼αcrT675M	4595–6969	pGM585	As above, derived from pGZα4946
pGM591	B42∼α	4595–6969	pJG4–5	EcoRI–SalI fragment of pGM583 cloned in the EcoRI–XhoI sites of the vector
pGM592	B42∼Cnr	7304–6983	pJG4–5	PCR with 119EcoRI–118SalIe
pGM607	B42∼αcrG732W	4595–6969	pJG4–5	EcoRI–SalI fragment of pGM588 cloned in the EcoRI–XhoI sites of the vector
pGM722f	CI∼α620–777	4639–5112	pC132	PCR with 401BamHI–402SalIe
pGM723f	CI∼α664–777	4639–4980	pC132	PCR with 401BamHI–403SalIe
pGM724f	CI∼α707–777	4639–4851	pC132	PCR with 401BamHI–404SalIe
pGM726f	CI∼Cnr	6987–7304	pC132	PCR with 399BamHI–400SalIe
pGM727f	CI*∼Cnr	6987–7304	pC169	PCR with 399BamHI–400SalIe
pGM729f	CI∼α707–730	4780–4851	pC132	PCR with 413BamHI–404SalIe
pGM730f	CI∼α707–747	4729–4851	pC132	PCR with 414BamHI–404SalIe
pGM731f	CI∼α724–777	4639–4800	pC132	PCR with 401BamHI–411SalIe
pGM732f	CI∼α741–777	4639–4749	pC132	PCR with 401BamHI–412SalIe
pGM738	CI∼α664–777	4639–4980	pC168	Substitution of the SalI–BamHI fragment from pGM723
pGM740	CI∼α741–777	4639–4749	pC168	Substitution of the SalI–BamHI fragment from pGM732
pGM773f	CI∼αcr620–777G732W	4639–5112	pC132	PCR on pGZα4776A DNA with 401BamHI–402SalIe
pGM774f	CI∼αcr620–777G732V	4639–5112	pC132	PCR on pGZα4775B DNA with 401BamHI–402SalIe
pGM775f	CI∼αcr620–777T675M	4639–5112	pC132	PCR on pGZα4946 DNA with 401BamHI–402SalIe
pGM776	CI∼α620–777	4639–5112	pC168	PCR with 401BamHI–402SalIe
pGM778	CI∼αcr620–777G732W	4639–5112	pC168	PCR on pGZα4776A DNA with 401BamHI–402SalIe
pGM779	CI∼αcr620–777G732V	4639–5112	pC168	PCR on pGZα4775B DNA with 401BamHI–402SalIe
pGM780	CI∼αcr620–777T675M	4639–5112	pC168	PCR on pGZα4946 DNA with 401BamHI–402SalIe
pGM794	CI*∼Cnr	6987–7304	pC168	Substitution of the BamHI–EcoRI fragment from pGM727
pGZ119				CamR; ptac; V origin	33
pGZαg	α	4595–7041	pGZ119		18
pGZα4773g	αcrL733V	4595–7041	pGZ119		18
pGZα4776Ag	αcrG732W	4595–7041	pGZ119		18
pGZα4775Bg	αcrG732V	4595–7041	pGZ119		18
pGZα4946g	αcrT675M	4595–7041	pGZ119		18
pJG4–5d	B42				21
pJK101d					21
pMS119HE				AmpR; ptac; V origin;	34
pSH17–4d	LexA∼Gal4				21
pSH18–34d					21
pST106	Cnr	7307–6976	pMS119HE		17
pUC19				AmpR; plac; ColE1 origin	35

^aThe protein expressed by the plasmid is indicated. CI*, mutant λ CI repressor protein unable to bind DNA (27); ∼, fusion protein.

^bCoordinates of the cloned P4 region are from the complete P4 sequence (36; GenBank accession no. X51522).

^cKindly provided by F. Gigliani.

^dKindly provided by R. Brent.

^eThe P4 fragment obtained by PCR amplification with the pair of oligonucleotides indicated was digested with the appropriate enzymes and cloned in the corresponding sites of the vector. Unless otherwise stated, the PCR has been performed on P4 DNA. The restriction site is in italic. The sequence complementary to P4 is underlined. 118SalI(ACGCGTCGACTCAGTGCAGTACCGGCGC); 119EcoRI(ACGAATTCATGAAAACACCCTTACCGCC); 399BamHI(ATTGGATCCGCTAGTGCAGTACCGGCGCTTTTATGTG); 400SalI(GATCGTCGACTATGAAAACACCCTTACCGCCCG);

401BamHI(GAAGGATCCGCTAGGCTGTTGTAGGGTCGTCAC); 402SalI(GATTGTCGACTCCGCAGGAGCGCGAC);

403SalI(GATTGTCGACTGAGGCACTGAACATCAAACGG); 404SalI(CTCGGTCGACTCTCTATCACGCCTATCTGGCC);

411SalI(CTCGGTCGACTCTCAGTCTGAAAATGTTCGGG); 412SalI(GTGGGTCGACTGGACTGAATTACGAGAAACGC);

413BamHI(GAAGGATCCGCTACCCGAACATTTTCAGACTGAG); 414BamHI(GAAGGATCCGCTAGCGTTTCTCGTAATTCAGTCC). The sequence of the cloned fragments was confirmed by sequencing.

^fIn such constructs, a UAG stop codon separates the α gene from a downstream in frame lacZ gene. Thus, after transformation of strain 71.18, which carries a tRNA amber suppressor, the colonies had a blue color in the presence of X-Gal.

^gKindly provided by R. Calendar.