TABLE 1.
Sequences, coverage, specificity, and annealing temperatures of the qPCR primer sets used in this study
| Target (16S rRNA gene) | F or Ra | Name | Abbreviated name | Sequence (5′ to 3′) | Coverage in the clone library for the bench-scale BAC at dayb: |
Specificityc | Annealing temp (°C) | Source or reference | |
|---|---|---|---|---|---|---|---|---|---|
| 100 | 244 | ||||||||
| Dechloromonas | F | S-G-Dchm-0146-a-S-24 | Dchm0146F | TATCGGAACGTACCTTTCAGTGGG | 24/25 | 67/67 | 184/351 | 67.0 | This study |
| R | S-G-Dchm-0248-a-A-24 | Dchm0248R | GCTAATCTGATATCGGCCGCTCAA | 25/25 | 66/67 | 227/426 | This study | ||
| Azospira | F | S-G-Azsp-1009-a-S-24 | Azsp1009F | TACCCTTGACATGCCAGGAACTTT | 1/1 | 10/13 | 45/185 | 68.0 | This study |
| R | S-G-Azsp-1163-a-A-24 | Azsp1163R | CGGCAGTCTCATTAAAGTGCCCAA | 1/1 | 10/13 | 45/1046 | This study | ||
| Bacteria | F | S-D-Bact-1369-a-S-18 | Bact1369F | CGGTGAATACGTTCYCGG | 138/163 | 101/129 | —e | 56.0 | 48 |
| R | S-D-Bact-1492-a-A-19 | Bact1492R | GGWTACCTTGTTACGACTT | NAd | NA | — | 48 | ||
F, forward; R, reverse.
Number of target clones with perfect match to the corresponding primer/number of target clones in the clone library. The denominator for the Azospira primer set (i.e., 13) is different from the number calculated from Table 2 (i.e., 14), because Table 2 was based on the early half of the 16S rRNA gene sequence, whereas the Azospira primer set is targeting the late half of the 16S rRNA gene sequence. The denominator for the Dechloromonas primer set (i.e., 67) is slightly different from the number calculated from Table 2 (i.e., 65).
Number of target sequences in database with perfect match to the corresponding primer/number of sequences in database with perfect match to the corresponding primer. The nontarget sequences with perfect matches to the corresponding primer are not detected in the clone library results. Therefore, little interference is expected for the qPCR results. The numbers of sequences were obtained from the Probe Match function in RDP in August 2008.
NA, not available. The PCR primers used to construct the clone libraries were 8F and 1387R, which do not cover the region around 1492. Therefore, the coverage of the 1492R primer in the clone libraries is not available.
—, for the bacterial primer set, specificity was not measured.