Table 1.
Allele frequencies of MATE1 variants in the proximal promoter
| Identification | Variant | Allele Frequency | |||
|---|---|---|---|---|---|
| African American |
European American |
Chinese American |
Mexican American |
||
| V1 | g.−66T>C | 0.445 | 0.321 | 0.231 | 0.289 |
| V2 | g.−53C>G | 0.017 | 0.054 | 0.031 | 0.078 |
| V3 | g.−48_−26delGTACCCACTGCCGGCCTCCGCG | 0.025 | 0.000 | 0.000 | 0.000 |
| V4 | g.−44C>T | 0.015 | 0.015 | 0.029 | 0.008 |
| V5 | g.−27_−26insGTACCCACTGCCGGCCTCCGCG | 0.037 | 0.059 | 0.044 | 0.068 |
Data were obtained from a DNA samples from 272 unrelated individuals including 68 from each of four major ethnic groups.
Position of the variant is based upon the translational start site.