Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer and template sequences for creation of riboprobes used in ISH. The original template sequence is given, as well as the gene-specific sequences used in the forward and reverse primers to amplify the riboprobe sequence from the template. An SP6 polymerase tag (GCGATTTAGGTGACACTATAG) was also added to the reverse primer sequence to enable in vitro transcription to generate the DIG or DNP labeled riboprobe. Template length is given in nucleotides.
