Table 1.

Oligonucleotides used in this study

Numbera	Name	Target/Purpose	Sequence (5' to 3')b
1	Bsamut-fwd	Introduction of silent mutation in OspA L10 codon yielding BsaI site	GGGAATAGGTCTCATATTAGCCTTAATAGC
2	Bsamut-rev	Introduction of silent mutation in OspA L10 codon yielding BsaI site	TGCTATTAAGGCTAATATGAGACCTATTCC
3	Bstmut-fwd	Introduction of silent mutation in mRFP1 V15R16 codons yielding BstBI site	TGCGCTTCAAGGTTCGAATGGAGGGCTCCG
4	Bstmut-rev	Introduction of silent mutation in mRFP1 V15R16 codons yielding BstBI site	GGAGCCCTCCATTCGAACCTTGAAGCGCATGAAC
5	Rmut-oligo	Random mutagenesis oligo	TATTTATTGGGAATAGGTCTCATATTAGCCTTAATAGCATGTAAGCAAAATGCCTCCTCCNNKNNKGTCATCAAGGAGTTCATGCGCTTCAAGGTTCGAATGGAGGGCTCCGTG
6	Rmut-rev	Generation of double-stranded DNA from Rmut-oligo	CACGGAGCCCTCCATTCGAACC
7	Mutscreen-fwd	Amplification of mutated ospA:mrfp1 region from PflaB	ATGCTATTGCTATTTGCGTTTC
8	Mutscreen-rev	Amplification of mutated ospA:mrfp1 region from ospA	ATGGTCTTCTTCTGCATTAC
9	Mutscreen-seq	Sequencing of amplified ospA:mrfp1 region from PflaB	AAAGGATTTGCCAAAGTCAG

^aNumbers correspond to primer numbers indicated in Figure 1.

^bIntroduced restriction sites are underlined; mutated nucleotides are in bold.