Table 4.

Kinetic data for unnatural base pair and mispair extension via dCTP incorporation with dMMO2 derivatives in the template.^[a]

5′-d(TAATACGACTCACTATAGGGAGAY
3′-d(ATTATGCTGAGTGATATCCCTCTXGCTAGGTTACGGCAGGATCGC
X	Y	kcat (min−1)	KM (μM)	kcat/KM (M−1 min−1)
dMMO2	d5SICS[b]	3.8 ± 0.3	5.7 ± 1.2	6.7 × 105
	dMMO2[b]	0.87 ± 0.28	160 ± 47	5.3 × 103
	dA[b]	8.7 ± 0.9	190 ± 17	4.6 × 104
	dG[b]	nd[c]	nd[c]	<1.0 × 103
	dC[b]	3.9 ± 1.32	3.2 ± 0.23	1.2 × 106
	dT[b]	6.2 ± 0.8	9.4 ± 1.0	6.6 × 105
d5FM	d5SICS	3.2 ± 0.7	1.4 ± 0.3	2.3 × 106
	d5FM	2.6 ± 0.39	99 ± 17.9	2.6 × 104
	dA	5.5 ± 0.08	17 ± 1.6	3.2 × 105
	dG	nd[c]	nd[c]	<1.0 × 103
	dC	2.4 ± 0.23	1.2 ± 0.10	2.0 × 106
	dT	4.1 ± 0.19	2.1 ± 0.17	2.0 × 106
d5ClM	d5SICS	7.8 ± 1.47	1.5 ± 0.37	5.3 × 106
	d5ClM	2.7 ± 0.19	80 ± 14.5	3.4 × 104
	dA	7.0 ± 0.19	7.3 ± 3.1	9.6 × 105
	dG	nd[c]	nd[c]	<1.0 × 103
	dC	2.8 ± 0.34	0.54 ± 0.14	5.2 × 106
	dT	4.2 ± 0.79	0.95 ± 0.10	4.4 × 106
d5BrM	d5SICS	6.8 ± 2.0	2.0 ± 0.18	3.4 × 106
	d5BrM	1.5 ± 0.1	46 ± 8.3	3.2 × 104
	dA	5.6 ± 0.2	8.5 ± 1.1	6.5 × 105
	dG	nd[c]	nd[c]	<1.0 × 103
	dC	2.5 ± 0.07	2.4 ± 0.02	5.9 × 106
	dT	3.6 ± 0.1	0.85 ± 0.07	4.3 × 106
d5IM	d5SICS	4.1 ± 1.6	1.1 ± 0.3	3.6 × 106
	d5IM	0.91 ± 0.18	120 ± 13	7.4 × 103
	dA	5.9 ± 0.9	12 ± 0.3	4.9 × 105
	dG	nd[c]	nd[c]	<1.0 × 103
	dC	1.8 ± 0.02	0.30 ± 0.03	5.9 × 106
	dT	3.1 ± 0.4	0.58 ± 0.05	5.2 × 106
d5MeM	d5SICS	4.6 ± 0.5	2.1 ± 0.05	2.2 × 106
	d5MeM	3.9 ± 0.12	59 ± 11	6.5 × 104
	dA	3.8 ± 1.0	18 ± 5.7	2.2 × 105
	dG	nd[c]	nd[c]	<1.0 × 103
	dC	2.4 ± 0.08	0.80 ± 0.07	3.0 × 106
	dT	5.2 ± 1.4	4.8 ± 1.9	1.1 × 106
d5PrM	d5SICS	7.5 ± 2.81	5.8 ± 2.5	1.3 × 106
	d5PrM	0.98 ± 0.17	230 ±150	4.2 × 103
	dA	5.2 ± 0.09	21 ± 6.6	2.4 × 105
	dG	nd[c]	nd[c]	<1.0 × 103
	dC	2.9 ± 0.25	0.67 ± 0.03	4.3 × 106
	dT	2.7 ± 0.37	1.8 ± 0.8	1.2 × 106

^[a]see Experimental section for details.

^[b]Reference 5.

^[c]Reaction was too inefficient for k_cat and K_M to be determined independently.