Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| ID | Tags (del+act) | Mature sequence |
| nov-miR-1 | 155 (101+54) | ggggugugcucagagcagguggccu |
| nov-miR-2 | 24 (4+20) | acccgucccguucguccccgga |
| nov-miR-3 | 15 (8+7) | aggggagcuagguagaaagcca |
| nov-miR-4 | 151 (75+76) | auuggaguucaugcaaguucu |
| nov-miR-5 | 16 (11+5) | cccuggaaggagacguggauuc |
| nov-miR-6 | 177 (70+107) | cuaaggcaggcagacuucagugu |
Note: Novel miRNAs were predicted by miRDeep. The miRDeep cut-off score was set at 1.
