Table 1.
Primer and adapter sequences used for first- and second-strand cDNA synthesis and specific amplification of cDNA ends
| Primer | Sequence (5′ – 3′) | Application |
|---|---|---|
| Adapter A | AUCUCGAGUUCGCGCCGGAUCC(T)25VN | cDNA synthesis and adapter-A incorporation |
| Adapter B | AUAUGCACUGCCGCGUCUGAGGGGGGGG | Cap finder adapter-B incorporation |
| Primer A | CUCGAGUUCGCGCCGGAUC | Second-strand cDNA synthesis |
| Primer B | AUAUGCACUGCCGCGUCUGA | Second-strand cDNA synthesis |
| 5′ T-RACE primer | ATATGCACTGCCGCGTCTGA | 5′ specific amplification of cDNA ends |
| 3′ T-RACE primer | CTCGAGTTCGCGCCGGATC | 3′ specific amplification of cDNA ends |