Table 1.
Real-time RT–PCR primers for expression of specific genes in rat BMSCs
| Genes | Sequences of primer(5′- 3′) | Amplicon (bp) | Tm (°C) | Genbank access number |
|---|---|---|---|---|
| Cbfa1 | Forward: tcccagtatgagagtaggtgtcc | 164 | 52.17 | NM_053470 |
| Reverse: ggctcagataagaggggtaagac | 52.17 | |||
| Col-I | Forward: tctgactggaagagcggagag | 112 | 57.14 | NM_053304 |
| Reverse: gagtggggaacacacaggtct | 57.14 | |||
| ALP | Forward: cctagacacaagcactcccacta | 138 | 60.72 | NM_013059 |
| Reverse: gtcagtcaggttgttccgattc | 60.92 | |||
| OC | Forward: gaccctctctctgctcactctg | 124 | 59.09 | NM_013414 |
| Reverse: caccttactgccctcctgctt | 57.04 |
ALP, alkaline phosphatase; BMSC, bone marrow-derived mesenchymal stromal cell; bp, base pair; Col-I, collagen I; OC, osteocalcin.