Skip to main content
. Author manuscript; available in PMC: 2011 Dec 1.
Published in final edited form as: Hypertension. 2010 Oct 25;56(6):1096–1101. doi: 10.1161/HYPERTENSIONAHA.110.160176

Table 1.

Real Time PCR Primers

TARGET Real Time PCR
Forward Primer
Sequence (5’-3’)
Real Time PCR
Reverse Primer
Sequence (5’-3’)
Base Pair Size of
Amplicon (bp)
rPDE4A gcctgatcctttttcccttc tttggggacttcagttcctg 221
rPDE4B cccgcagctgtagtagaagc caggcatttcaaagacacga 215
rPDE4C gcagcatggttcaatggtta atatcagctgggagcctggt 159
rPDE4D agaggaagatggcgagtcag tcaggacaacaatcgtctgc 201
rPDE4B1 gcaaacagcagacatctcca ccttgccctttcactttgtc 236
rPDE4B2 gtcttgtccgggtcagtgtt gctttcccctctctttgctt 165
rPDE4B3 gccaggctttgcttactgtc gccaaagtgcttcctctgtc 209
rPDE4B4 cctcgtgtgtcgattgctaa tctccatgcgtttctctgtg 150
rPDE4B5 tctgtatcttggggttacatca gttacgaaggtgtcggagga ~445
β-actin actcttccagccttccttc atctccttctgcatcctgtc 171