Table 2.
Primers, probes and conditions used for semi-quantitative real-time PCR
| Product | Forward primer 5'-3' | Reverse primer 5'-3' | Annealing Temp. (°C) | Probe No.a | Amplicon size (bp) |
|---|---|---|---|---|---|
| ELF1A | acgaggctctgacggaag | cacgacgcaactccttcac | 60 | 165 | 81 |
| IrCL | aaccacctggggtgatga | caagaggtatgctagcactgga | 60 | 15 | 89 |
| IrCD | gacagaaggcggacagtacc | cggaaattgtgaaggtgacat | 60 | 78 | 74 |
| IrAE | cgaaaccgtgctttcctg | tcagtcttctcagcgtcacc | 60 | 22 | 77 |
| IrCB | tcaacaagatcaacacaacttgg | tcatggagatggatttgtcg | 60 | 4 | 60 |
| IrCC | caccaagaacagggtgaagaa | ctcgcaaccctgagagtagg | 60 | 15 | 76 |
a For the Roche Universal ProbeLibrary Nos. see: https://www.roche-applied-science.com/sis/rtpcr/upl/index.jsp