TABLE 3.
Primers used for PCRs
| Primer name | Sequencea | Restriction site(s) | Locationb | Promoter fragment(s) generatedc |
|---|---|---|---|---|
| RR15-71 | GGGGGATCCGCTCGACTTGCATGTAT | BamHI | Downstream | rrnJp2, rrnJp1p2, rrnOp2 |
| RR15-72 | GGGAAGCTTGCCGCTAAACAAGGCG | HindIII | Upstream | rrnJp2 |
| RR15-73 | GGGGAAGCTTCCCCTTCTATTCGCGAT | EcoRI | Upstream | rrnJp1, rrnJp1p2 |
| RR15-74 | GGGAAGCTTCGCCTTGTTTAGCGGC | HindIII | Downstream | rrnJp1 |
| RR15-77 | CCGGATCCTGCAGACACAAGCATGACC | BamHI, PstI | Upstream | rrnOp2 |
| RR15-78 | CCGGATCCTAGTCATAATGGTCATGC | BamHI | Downstream | rrnOp1 |
| RR15-79 | GGGAAGCTTCTGCAGGTGCGTCTCAT | HindIII, PstI | Upstream | rrnOp1 |
a
Regions of primers complementary to target template DNA are underlined; restriction enzyme sites are in boldface.
b
The priming site of the oligonucleotide with respect to the indicated promoter(s). Upstream primers are sense sequences, and downstream primers are antisense sequences.
c
Some primers were used to generate several different promoter fragments.