TABLE 2.
Use and oligonucleotide | Sequence (5′-3′)a | Location |
---|---|---|
qRT-PCR | ||
L-0004 | ATACACGAAGAAGAAGGTGTTTCAG | Internal region within plu0004 |
R-0004 | TACCTGTCTGTTCAGTTTCTCCAAC | Internal region within plu0004 |
L-0157 | ATGAAGAGCTGATTGTCGATGATG | Internal region within plu0157 |
R-0157 | CGTAAAAGAGAAAGATAGAGCAGCAC | Internal region within plu0157 |
L-0183 | AGTGTGGAACGTTGGATAGATAGAG | Internal region within plu0183 |
R-0183 | AAGTATAGCTGCACCTACAGAACAAC | Internal region within plu0183 |
L-1537 | ACTTATCCAGGATTCTATTCGTCTG | Internal region within plu1537 |
R-1537 | ACTATAGATTTCGCCTTTGCTATCC | Internal region within plu1537 |
L-1752 | CCTACGATATAGGCAATGGTATCAG | Internal region within plu1752 |
R-1752 | ACAATATCTTGGTAGCCGAAAGAG | Internal region within plu1752 |
L-1956 | GTACCTGTTTGAACAGACTGAAATG | Internal region within plu1956 |
R-1956 | TTGTAGTTACTGAATGCTGACTGTG | Internal region within plu1956 |
L-1991 | GCTAATATTTCCGTAGGCTCTCATC | Internal region within plu1991 |
R-1991 | GGACGTAATCAAAGTGTAATTCTCG | Internal region within plu1991 |
L-2442 | AATAGGCAATATGCTGTACGTCTTC | Internal region within plu2442 |
R-2442 | CAGACCGCAAATACAATAAAGTAGG | Internal region within plu2442 |
L-3506 | TTAAGGGCGATATTGATGTAGAAGG | Internal region within plu3506 |
R-3506 | TTGATAGACATACTGCTGCAACGAC | Internal region within plu3506 |
L-4092 | GACAGTGACCATGAACAGACATAAC | Internal region within plu4092 |
R-4092 | ATATTGGGTTGCTGGTTTAGAGAG | Internal region within plu4092 |
L-4546 | CTGCCGATATAATTGCAGCTTTAC | Internal region within plu4546 |
R-4546 | CCAAATTTCTGAAGGGTGTATTTCC | Internal region within plu4546 |
Plasmid constructions | ||
XhoI-L-plu1537 | GCGCCTCGAGTTAAAATCAATCACAAGAGG | Upstream of plu1537 |
PstI-R-plu1537 | GCGCCTGCAGAATATCTTCTCACAGGAATGG | Downstream of plu1537 |
XhoI-L-plu4093 | GCGCCTCGAGTTAATGAGGAAAATAAATATGTC | Upstream of plu4093 |
PstI-R-plu4092 | GCGCCTGCAGCTACGTACATAAAATATACTTGTTAAA | Downstream of plu4092 |
XhoI-L-plu2444 | GCGCCTCGAGGAGGCCGATAGCTTCCAAC | Upstream of plu2444 |
PstI-R-plu2441 | GCGCCTGCAGAAAGCGTAGCAATGTTCCTG | Downstream of plu2441 |
Restriction enzyme sites are underlined.