Table 1.
Genes tested in both computational and biochemical assays
| Gene ID | Gene | Regulation | Computational matching of regulatory consensus | Position of DNA fragment used § | |||
|---|---|---|---|---|---|---|---|
| Position§ | Sequence | Score | LacZ | Footprinting | |||
| YPO1222 | ompC | + | R-191...-169 | AAACAGTGAGTTATAGCACATAT | 12.3 | -379...+130 | -281...-26 |
| YPO1411 | ompF | + | D-131...-109 | ACTTTGTGACTTAGATCGAATTT | 10.73 | -328...+143 | -237...-4 |
| YPO2506 | ompX | - | D-156...-134 | AGTATGTGACCTCCATCACCCAA | 11.68 | -374...+123 | -321...+4 |
| YPO0136 | ompR | NO | - | - | 0 | -409...+83 | -409...+83 |
| YPO0175 | crp | NO | R+235...+257 | GAACTCTGAGCCCTGTTAAGTTA | 1.44 | -147...+344 | -147...+344 |
§, The numbers indicate the nucleotide positions upstream of the transcription start sites
+, positive and direct regulation
-, negative and direct regulation