Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study
| Primers | Sequence (5'→3') | Reference |
|---|---|---|
| 16S P1 | AGAGTTTGATCCTGGTCAGAACGCT | Yanagi and Yamasato, 1993 |
| 16S P2 | TACGGCTACCTTGTTACGACTTCACCCC | Yanagi and Yamasato, 1993 |
| ITS1 | TCCGTAGGTGAACCTGCGG | White et al, 1990 |
| ITS4 | TCCTCCGCTTATTGATATGC | White et al, 1990 |
| RV-M | GAGCGGATAACAATTTCACACAGG | Takara, Code No. D3880, Japan. |
| M13-47 | CGCCAGGGTTTTCCCAGTCACGAC | Takara, Code No. D3887, Japan. |
