Table 1.
Characteristics of seven microsatellite loci developed for the cat flea
| Locus | Repeat motif | Primer sequences (5′-3′) |
Tm (°C) |
NGT | Size (bp) |
NA | He | Ho | GenBank accession |
|---|---|---|---|---|---|---|---|---|---|
| F2-8D | (ACT)3(CCT)(ACT)3(ATT)(ACT)6ACC(ACT)8 | F:gccttgttacaaacccggta | 59.9 | Lab: 60 | 188–245 | 6 | 0.44 | 0.23 | GU784825 |
| R:cacgtgacacccctctatcc | 60.4 | Parker: 33 | 4 | 0.47 | 0.21 | ||||
| F4-3D | (ACTT)2 (ACAT)2 (ACTT)(ACAT)(ACTT)13 | F:tagtgcgtttgttgcctcac | 59.9 | Lab: 56 | 172–176 | 2 | 0.12 | 0.13 | GU784827 |
| (ACTC)2(ACTT)3(ATTT)(ACTT)3 | R:aagaaagactctgctgcatgg | 59.6 | Parker: 35 | 1 | 0.00 | 0.00 | |||
| F4-5B | (CA)5 … (CA)2 … (CA)2A(CA)3ACACT(CA)2 | F:agggcctcctctcattcact | 60.2 | Lab: 55 | 141–165 | 2 | 0.15 | 0.16 | GU784828 |
| R:ggggacatggatgttttctg | 60.2 | Parker: 29 | 2 | 0.03 | 0.03 | ||||
| F4-7F | (GTTT)2 … (GTTT)6 | F:gccttgctagcagaagccta | 59.9 | Lab: 52 | 165–317 | 6 | 0.75 | 0.44 | GU784829 |
| R:gtaccgagctcgaatccact | 59.3 | Parker: 36 | 6 | 0.44 | 0.39 | ||||
| F4-1F | (TG)2 TTC(TG)3 | F:ctgcatgttgattcgtccag | 60.3 | Lab: 56 | 170–182 | 2 | 0.12 | 0.09 | GU784826 |
| R:tagcaccgcaagttatgtcg | 59.9 | Parker: 33 | 1 | 0.00 | 0.00 | ||||
| F2-10A | (GTCT)7 | F:gcatttgtatgtaacgccaaga | 60.0 | Lab: 58 | 207–283 | 15 | 0.60 | 0.35 | GU784830 |
| R:gatcgtctttgagccgaaac | 59.8 | Parker: 25 | 14 | 0.87 | 0.40 | ||||
| F3-3H | (CAG)5 | F:gcagaagcctgtggtggtag | 60.9 | Lab: 55 | 470 | 1 | 0.00 | 0.00 | GU784831 |
| R:ctcaggggtggtcactgttt | 60.0 | Parker: 32 | 1 | 0.00 | 0.00 |
Tm, melting temperature; NGT, number of individuals genotyped per locus and population (Lab, Parker); NA, number of alleles per locus and population; He, expected heterozygosity; Ho, observed heterozygosity; F:, forward; and R:, reverse. Data sets of the two laboratory populations were combined because they did not show genetic differences. Repeat motifs are in bold letters.