Table 1.

The sequences of primers and probes used in real-time PCR analysis

Gene name	Accession no.	Primer sequence (5′–3′)		Probe no.
β-Actin	NM_031144	Forward	cccgcgagtacaaccttct	17
		Reverse	cgtcatccatggcgaact
ChAT	NM_001170593	Forward	gcctcatctctggtgtgctt	120
		Reverse	cagtcagtgggaagggagtg
CHT1	NM_053521	Forward	cattggtttgttggttggtg	83
		Reverse	gctgtcccgttgatgtaacc
OCT1	NM_012697	Forward	gctagctgtgtccctgccta	4
		Reverse	gggattctgggacaaacca
OCT2	NM_031584	Forward	ctgtgactctgcccaacttct	15
		Reverse	ggagatcagccatcttggag
OCT3	NM_019230	Forward	gactggcgctatgtggagac	22
		Reverse	gccgcagacaaggtcaaa
VAChT	NM_031663	Forward	tgcaagagcactgtccaact	10
		Reverse	cgaggggctagggtattcat

Listed probe numbers indicate the product number of the Universal ProbeLibrary Set and Human and Extension Set sold by Roche Applied Science.