Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Genes and their primers used for quantitative RT-PCR
| Genes | Forward primer | Reverse primer |
|---|---|---|
| Slc6a4 | agtcaaaacgtctggcaagg | gtttctgccagttgggtttc |
| Htr1b | ctatttcgttgccacccttc | tcggtgttcacaaagcagtc |
| Slc1a3 | acatgttccctcccaatctg | tttcgttggactggataggc |
| S100b | tgccctcattgatgtcttcc | tgctccttgatttcctccag |
| Maoa | atggaaggtgcagttgaagc | aagagctggaacatccttgg |
| Gap43 | aagataccaccatgctgtgc | ttatcttccggcttgacacc |
