Skip to main content
. Author manuscript; available in PMC: 2011 Oct 1.
Published in final edited form as: Ann N Y Acad Sci. 2010 Oct;1207(Suppl 1):E7–15. doi: 10.1111/j.1749-6632.2010.05714.x

Figure 4.

Figure 4

Expression of sVEGFR-2 in 49 neuroblastoma (NB) tissue samples, as determined by real-time RT-PCR. The expression levels (bars, and standard error of the mean) are shown separately for each tumor stage. Tumor stages 3, 4 and 4s (progressed NB) demonstrate statistically (p < 0.05) significantly lower levels of sVEGFR-2 compared to localized stages 1 and 2. Primers used for RT-PCR were: sVEGFR-2 fwd: 5′- GCCTTGCTCAAGACAGGAAG -3′; sVEGFR-2 rev: 5′- CAACTGCCTCTGCACAATGA -3′. β-Actin fwd: 5′- GCATCCCCCAAAGTTCACAA -3′; β-Actin rev: 5′- AGGACTGGGCCATTCTCCTT -3′.