FIG. 2.
Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis of splice site mutations in the C160rf57 gene. A: RT-PCR of segment that includes the c.693+1G>T donor splice site mutation and spans exon 3/4 to the 3’ UTR using primers: Forward – CCTCCTTCCACAGATTCTTC. Reverse – GTTCCTCCATCTCAGCCTG. Both siblings (Patients 7 and 8) are heterozygous for this mutation. B: RT-PCR of segment that includes the c.266-1G>A acceptor splice site mutation and spans the 5’ UTR to exon 5 using primers: Forward – CTGCTCTGGTGGTCTTGGAT; Reverse -AGAAGGATCCTGGTAGAAAGTG. The patient is homozygous and his father is heterozygous for this mutation.