TABLE 3.
Three sequence-tagged site (STS) markers linked to Sr39 located on short Aegilops speltoides chromosome segment in the four new wheat lines
| Band size (bp) |
EST accession or genomic groupc | ||||
|---|---|---|---|---|---|
| Marker | Primer sequence | Tm (50 mM Na+) (°C)a | RL6082 | CSb | |
| Xrwgs27 | 5′ GCCTTGGTGGATTTTGTGAT 3′ | 60 | 740 | 710 | BG275030 |
| 5′ GCGCTTTCAGTACAGGGTTC 3′ | 60 | ||||
| Xrwgs28 | 5′ AGAGCCTGGGACTGTTGCTA 3′ | 60 | 360/450/520 | 350 | tplb0012l12 |
| 5′ CAATGGCACTCTTCAAAGCA 3′ | 60 | ||||
| Xrwgs29 | 5′ CGGCTATTGCTCAAAGAAGG 3′ | 60 | 540 | 550 | tplb0012l12 |
| 5′ TGTTTCTGTCAGAGGCAACG 3′ | 60 | ||||
Melting temperature.
CS, Chinese Spring.
Wheat EST (expressed sequence tag) accessions were obtained from Website: http://wheat.pw.usda.gov/cgi-bin/westsql/map_locus.cgi (verified on November 27, 2010). The genomic clone tplb0012l12 sequence (4162 bp) was obtained from Website: http://www.shigen.nig.ac.jp/wheat/komugi/ests/cdnaQueryAction.do?cloneName=tplb0012l12&resourceTypeId=2 (verified on November 27, 2010), which contains a hypothetical protein OsI_27446 of rice (Oryza sativa L.) Indica Group.