Table 2. Some M. grisea expressed genes in blast-infected rice leaves as revealed by SuperSAGE.
Tag sequence* | Count | GenBank accession no.; putative protein† |
---|---|---|
CGATCACGAGGGGATGATGGTG | 38 | L20685; hydrophobin |
TCAGACACAGGCTGTACAAGGC | 2 | Nucleoside-diphosphate kinase |
TCACGTTTAGAAAGGCGACCCG | 2 | 60S ribosomal protein |
TTGCCCGTATGTACATAAACAA | 1 | BM865406; NADH-ubiquinone oxidoreductase |
CAATTGGTGTTTCTTTGGGTTT | 1 | AF056625; poly-ubiquitin |
TCGTCTGTGGCTTCAGTTGCTG | 1 | Unknown protein |
ACGAGCTGATGCGCAAGGATGG | 1 | ABC transporter |
Total number of tags presumably derived from M. grisea | 74 |
Tags represented as a 22-bp sequence excluding the NIaIII site (CATG).
Putative protein was deduced from cDNA sequence and genomic sequence of M. grisea that matched the corresponding tag.