. 2011 Feb 1;90(3):1137–1145. doi: 10.1007/s00253-011-3107-8

Table 1.

Primers and PCR conditions. Genomic DNA was extracted from 10 g of sediment sample using PowerMax™ Soil DNA Isolation Kit (Mo Bio Laboratories Inc, USA) and further purified using the TaKaRa Agarose Gel DNA Purification Kit (TaKaRa, China) according to manufacturer’s protocol

Target gene		Primer	Sequence (5′–3′)	Length of product (bp)	PCR program	Reference
amoA	AOA	cren amo_F (I)^a	ATGGTCTGGCTAAGACGMTGTA	632	(94°C, 45 s; 55°C, 45 s; 72°C, 45 s) ×35	Hallam et al. 2006
		Arch-amoAF (II)	STAATGGTCTGGCTTAGACG	635		Francis et al. 2005
		Arch_amoA_F (III)	AATGGTCTGGSTTAGAMG	633		De la Torre et al. 2008
		Arch-amoAR	GCGGCCATCCATCTGTATGT	633		Francis et al. 2005
	AOB	amoA-1F	GGGGTTTCTACTGGTGGT	491	(94°C, 45 s; 55°C, 45 s; 72°C, 45 s) ×35	Rotthauwe et al. 1997
	AOB	amoA-2R^a	CCCCTCKGSAAAGCCTTCTTC	491	(94°C, 45 s; 55°C, 45 s; 72°C, 45 s) ×35	Rotthauwe et al. 1997
16S rRNA	AOB	NitA	CTTAAGTGGGGAATAACGCATCG	518	(94°C, 45 s; 57°C, 45 s; 72°C, 45 s) ×35	Voytek and Ward 1995
16S rRNA	AOB	CTO654r	CTAGCYTTGTAGTTTCAAACGC	518	(94°C, 45 s; 57°C, 45 s; 72°C, 45 s) ×35	Kowalchuck et al. 1997

The concentration of DNA was determined by NanoDrop® Spectrophotometer ND-1000 (Thermo Fisher Scientific, USA). PCR was performed using FailSafe™ PCR Premix F (EPICENTRE Biotechnologies, Madison, USA) following the cycling program for each primer set listed here

^aPrimers used for T-RFLP analysis were labeled by Hex