Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Gene Sequencing. DNA sequence derived from a healthy control (upper) and from a patient with S window peak (lower). The sequencing chromatogram shows the same sequence in both individuals [GCCCTGTGGGGCAAAGTGAA] with the arrows indicating the peaks where HbA2' mutation was expected.
