Table 2. Overview on primers used in this study.
Elongation Primer | ||
Primer Name | Sequence (5′⇒3′) | Position in DQ000496* |
Head (SspI) | GGAGGAGTGGTTATATAGA | 74–91 |
Tail (NruI) | GTGTTACCGTCTCGAACCTAG | 5189–5209 |
The table summarizes sequences, genome locations, and names of primers used in the study. Primer were used in combinations as indicated in the text and for detection of intermediate DNA sequences as shown in table 2; *GenBank entry DQ000496 covers the first published HBoV isolate and presents the current reference sequence. (+) = forward; (−) = reverse.