. 2011 May;55(5):1896–1905. doi: 10.1128/AAC.01756-10

Table 2.

Primers designed and used in the present study

Primer application	Primer pair	Nucleotide sequence (5′–3′)	Nucleotide coordinates	Region amplified	Product size (bp)
Long-range PCR to confirm	orfX F1	`CATTCAGCAAAATGACATTC`	377–396^a	orfX to ACME arcA	7,887
the genetic organization	arcA R1	`AATGGTACAAGGACCCATTC`	8264–8245^a
of the ACME/SCCmec
region in ST22-MRSA-	arcA F1	`GTTTGAGCAAATTTGTCATG`	8088–8107^a	arcA to SCCmec I	8,647
IVh M08/0126				J1-like region
	ΔCE010 R1	`ATCAGGACTACCTGGTTCCA`	16735–16716^a
	ΔCE010 F1	`CATATGAAACTAAACGCGTA`	16683–16702^a	SCCmec I J1-like region to J3 region of SCCmec IVh	8,284
	J3IVh R1	`ACCAAGCTATCATAGGATGT`	24967–24948^a
Confirmation of genetic	orfX F1	`CATTCAGCAAAATGACATTC`	377–396^a	orfX to ACME	943
organization of ACME	ACMEII R1	`GAGACTGCTTCTTTGCTCAC`	1320–1301^a
and SCCmec in all
ACME arc-positive ST22-MRSA-IVh isolates	ACME/SCCmecI F1	`AGTTACTGCTAATGGAACGG`	23808–23827^a	SCCmec I J1-like region to J3 region of SCCmec IVh	1,159
	J3IVh R1	`ACCAAGCTATCATAGGATGT`	24967–24948^a
Confirmation of location of	IVa R1	`CACGTTATGGAGGTGCTCTG`	57628–57647^b	J1 region of SCCmec	495
ACME in all ACME arc-				IVa to ACME I
positive ST8-MRSA-IVa isolates and ST22-MRSA-IVa isolate E1401	C	`CCTCCTTCACTTAGCACTG`	58123–58092^b

Nucleotide coordinates based on the nucleotide sequence of the orfX-ACME-SCCmec region of ST22-MRSA-IVh isolate M08/0126 (GenBank accession number FR753166).

Nucleotide coordinates based on the nucleotide sequence of ST8-MRSA-IVa (USA300) strain FPR3757 (GenBank accession number NC007793).