Figure 1. The tobacco chlorophyll biosynthetic pathway gene CHLI is silenced upon CMV Y-Sat infection.

(A), The Y-Sat yellow domain matches a 22-nt sequence in the CHLI coding region. (B), CHLI is a key component in the chlorophyll biosynthesis pathway. (C) and (D), N. tabacum plants transformed with a CHLI RNAi construct (CHLI-RNAi; Figure 3B ) show leaf yellowing (C) that is associated with dramatic down-regulation of the CHLI gene (D). (E), The CHLI gene is silenced in CMV Y-Sat-infected tobacco plants. The top panel shows the analysed tobacco leaf tissues with different levels of yellowing symptoms. The middle two panels are of a northern blot gel showing down-regulation of CHLI mRNA upon CMV Y-Sat infection. The bottom two panels are of a small RNA northern blot gel hybridized with a 21-nt Locked Nucleic Acids (LNA) probe (5′ ATGAGAAATGCAGAGCTGAAA 3′) complementary to the CHLI-targeting Y-Sat siRNA (from nt. 179). Note that the severity of the yellowing symptoms correlates with the degree of CHLI silencing, which in turn shows good correlation with the level of Y-Sat siRNAs. (F), The content of two major chlorophylls (Chl-a and Chl-b) is dramatically reduced in CMV Y-Sat-infected tobacco leaves. (G), A unique CHLI fragment is amplified by 5′ RACE from the CMV Y-Sat-infected tobacco but not from the uninfected tissue, indicating Y-Sat siRNA-directed cleavage of the CHLI transcript at the predicted target site. The exact cleavage sites are indicated by arrows in (1A), and the number of sequenced clones for the respective cleavage product is given above each arrow.