Table 1.
PCR primers used in this study
| Name1 | Sequence (5'->3') | Used for |
|---|---|---|
| Pdh1-LP1 (A) | tctcctctatcccaacctctg | pdh1-1, GABI_308F08 (pdh1-3), SALK_119334 (pdh1-4) |
| Pdh1-RP1 (B) | gatcgctcactcgtttcagaag | |
| Pdh1-LP2 (C) | aagttggtgagaggggcttac | SALK_081276 (pdh1-2) |
| Pdh1-NS-r (D) | cgcaatcccggcgattaatctc | ProDH1 cloning |
| Pdh1-f | caccataATGgcaacccgtcttctc2 | |
| Pdh2-LP | gtaaccagcccctaaacctc | SALK_108179, GABI_918D08, SAIL_90_G05 |
| Pdh2-RP | ggagtactagatcgcgtgtaac | |
| Pdh2-LP2 (F) | aaaccctaccttcgtctcac | GT1788 (pdh2-1), GABI_328G05 (pdh2-2) |
| Pdh2-RP2 (G) | cactaacccgttttaggacattc | |
| Pdh2-LP3 | gagaagagttatggcttggtg | GABI_187C05 |
| Pdh2-RP3 | atgtccctttgtaatctgaattgg | |
| Pdh2-f (E) | caccataATGgcaaaccgtttcctc2 | ProDH2 cloning |
| Pdh2-NSr | ccaagccataactcttctcttaag | |
| Pdh2-Prom-f | catttggatccttaccatccac | ProDH2 promoter cloning |
| Pdh2-Prom-r | cgggatccgtttgcCATttaaactc2 | |
| Salk_LBb2 | ttcggaaccaccatcaaacag | SALK lines |
| Gabi-LB | cccatttggacgtgaatgtagacac | GABI lines |
| Sail-LB2 | gcttcctattatatcttcccaaattaccaataca | SAIL_90_G05 |
| Gus5'rev | atttcacgggttggggtttc | GT1788 |
| Put1KO-f | aaacatcgctacatagtaataacactaacgcacgcta gaaCGGATCCCCGGGTTAATTAA3 |
Put1 knockout |
| Put1KO-r | ttggtttgtctttgaaattggagtatatattatagtcctcG AATTCGAGCTCGTTTAAAC3 |
|
| SDH-f | caccacgagaataaagATGctatcgct2 | SDH-MTP |
| SDH-Pdh1-r | cttgttgtccaaaggagagCTCGTGATCTATTATGTG4 | SDH-MTP ProDH1 fusion |
| SDH-Pdh2-r | ggttggtcaaaggaaaggatCTCGTGATCTATTATGTG4 | SDH-MTP ProDH2-fusion |
| Put1-f | caccctagaaATGatagcttcc2 | Put1 cloning |
| Put1-r | taggcctactctttttggaatc | |
| Pdh1-pr-r | atggtcataaaacgtacttttcac | northern probes (with Pdh1-f or Pdh2-f) |
| Pdh2-pr-r | gactcatacacgctactcac | |
| P5CS1-f | aatgagaggaaaaggacaag | P5CS1 probe [8] |
| P5CS1-r | gataggatatgagtactaagcagag | |
| P5CDH-f | tggacagaagtgttctgcac | P5CDH probe |
| P5CDH-r | gcttccaacactagaggaag | |
1 Letters in brackets refer to the abbreviations in Figure 6; 2 capital letters indicate the translation start codon; 3 capital letters indicate the nucleotides specific for the resistance cassette, lower case letters correspond to Put1 5' and 3' sequences; 4 capital letters correspond to the 3' sequence of the SDH-MTP, lower case letters correspond to the nucleotides encoding the N-terminus of the predicted mature Arabidopsis ProDH proteins.