Table 1.

Comparison of D, K, C and P-type oligodeoxynucleotide.

ODN type	Representative sequence	Structural characteristics	Immune effects
D- also referred to as A-class	GGTGCATCGATGCAGGGGGG	Mixed phosphodiester/phosphorothioate backbone Single CpG motif CpG flanking region forms a palindrome Poly G tail at 3′ end	Induces strong pDC IFN-α secretion APC maturation
K- also referred to as B-class	TCCATGGACGTTCCTGAGCGTT	Phosphorothioate backbone Multiple CpG motifs 5′ motif most stimulatory	Induces strong B-cell activation pDC maturation Preferentially supports the production of TNF-α and IL-6
C	TCGTCGTTCGAACGACGTTGAT	Phosphorothioate backbone Multiple CpG motifs TCG dimer at 5′ end CpG motif imbedded in a central palindrome	Induces B-cell and pDC proliferation and differentiation Induces production of IL-6 and IFN-α
P	TCGTCGACGATCGGCGCGCGCCG	Phosphorothioate backbone Two palindromes Multiple CpG motifs	Stimulates pDC and B cells Strong IFN-α secretion

Bold letters in ODN sequences indicate self-complementary palindromes; CpG motifs are underlined.

APC: Antigen-presenting cell; ODN: Oligodeoxynucleotide; pDC: Plasmacytoid dendritic cell.