Table 8.
Summary of Available Information on ECSM1-3 and Magic Roundabout
| UniGene cluster ID and size | Full-length cDNA | Longest ORF | Transmembrane segments, signal peptide | Mapping information Genomic context Genomic clones | Description | |
|---|---|---|---|---|---|---|
| ECSMl | Hs.13957 1100 bp | 103 aa confirmed with 5′RACE | Genomic neighbour: Tropomyosin dbSTS G26129 and G28043 Chr. 19 Gene Map 98: Marker SGC33470, Marker stSG3414, IntervalD19S425D19S418 | |||
| AC005945, AC005795 (partial identity) | ||||||
| ECSM2 | Hs.30089 1023 bp | Identical to the full-length sequence in the “cDNA encoding novel polypeptide from human umbilical vein endothelial cell” patent (Shibayama et al. 1997) | 205 aa | Clear signal peptide (SignalP), two predicted transmembrane domains (TopPred2 and DAS) | Transmembrane protein, possibly an adhesion molecule | |
| 983 bp | ||||||
| ECSM3 | Hs.8135 1694 bp | AW888224-MXRA4 Matrix remodelling–associated gene 4 (Walker et al. 2000) 3047 bp | Genomic neighbour: endothelial specific Clq/MBL/SPA receptor (C1qRp, AA4, Ly68)—both genes contained within only 8 kb-region dbSTS G06859 Chr. 20, Gene Map 98: Marker sts-W72082, Interval D20S182D20S106 | Endothelial specific gene involved in matrix remodelling, possibly a novel metalloproteinase or ECM protein Possible 26 bp regulatory sequence shared with the endothelial-specific gene endothelin-converting enzyme-1 (E = 3e–04): CTTCCTGAAGCCTTGCTCCCTCCACC Possible regulatory sequence shared with the endothelial specific mouse AA4 gene (ClqRp, Ly68) 3′UTR (E = 2e–24) | ||
| AL118508, AC011137, HSJ737E23, and AL118508.27 on the NCBI Map Viewer | ||||||
| Magic roundabout | Hs.111518 2076 bp | Partial cDNA FLJ20798 fis, clone ADSU02031 (acc. AK000805) 1496 bp | 417 aa | One transmembrane domain predicted by TopPred2 and DAS No signal peptide detected in the available 417 aa ORF (SignalP); however, the true protein product is very likely to be larger | Genomic neighbour: integral transmembrane protein 1 (ITM1) dbSTS G14646 and G14937 Chr. 11, Gene Map 98: Marker SHGC11739, Interval D11S1353-D11S93 | 468 aa region of homology to the cytoplasmic portion of the roundabout axon guidance protein family: human ROBO1, rat ROBO1, and mouse dutt1 (E = 1.3e–0.9) ORF has no apparent upstream limit. This and size comparison to ROBO1 (1651 aa) suggest that true protein is very likely to be much larger Possible alternative polyA sites: the cDNA clone from adipocyte tissue seems to be polyadenylated in a different position to the sequence from the UniGene contig |