Skip to main content
. 2011 Mar 7;12(3):1727–1734. doi: 10.3390/ijms12031727

Table 3.

Details of primers used for each of the five evaluated genes.

Gene Accession No. Sequences[5′→3′] TM Product length [bp]
GAPDH sus AF017079 for gccatcactgccacccagaa 60 °C 153
rev gccagtgagcttcccgttga
Ubiquitin sus U72496 for accctgacgggcaagaccat 60 °C 143
rev cggccatcctccagctgttt
Histone H3 sus NM_213930 for actggctacaaaagccgctc 60 °C 232
rev acttgcctcctgcaaagcac
Beta-actin bov AY141970 for aactccatcatgaagtgtgacg * 60 °C 229
rev gatccacatctgctggaagg
18S rRNA sus DQ437859 for tggagcgatttgtctggtta 60 °C 200
rev acgctgagccagtcagtgta
*

incorrect sequence in forward primer (real CDS sequence in AY141970 aattccatcatgaagtgtgacg).