Skip to main content
. 2011 Apr 1;34(2):187–194. doi: 10.1590/S1415-47572011000200003

Table 1-.

Oligonucleotide pairs used and polymorphic sites investigated to classify mitochondrial coding regions into haplogroups H, V and U/K.

Haplogroup Primer sequences Polymorphic site Enzyme
H L: aagcaatatgaaatgatctgc
H: gcgtaggtttggtctag
–7025 AluI
V L: gagcttaaacccccttattt
H: gtattgattggtagtattggttatggttca
–4577 NlaIII
U/K L: ctcaaccccgacatcattacc
H: attacttttatttggagttgcaccaagatt
+12308 HinfI