Skip to main content
. 2001 Mar 27;98(7):4130–4135. doi: 10.1073/pnas.071056298

Figure 2.

Figure 2

Schematic representation of genomic pseudogenes. BAC 2439 is 45 kb in length. Msp3-11 is 3263 bp in length. It is shown to the same scale as BAC 2439 for comparison and is enlarged to show the positions of primers F1, F2, R1, and R2 used for amplification and cloning of pseudogenes. The sequence of the primers is as follows: F1: GCACCAAAGAATATAGCTGTAAATAC; F2: CCCAGCTTCTGCACAAAC; R1: TGTTGCCCGCCATCC; R2: CTCTAGCACCTTCAGCATC. The complete pseudogene complex is illustrated. Msp2 pseudogenes are striped and msp3 pseudogenes are dark gray. The orientation of pseudogenes is indicated by the direction of the arrow. Ovals indicate the presence of the conserved 600-bp sequence.