Table 1.
HBoV2 primers and probe used in the real-time PCR assay for gene target NP-1
| Primer or probea | Sequence (5′–3′) | Amplicon length (bp) | Positionb |
|---|---|---|---|
| Primer, forward | TCAGACCAAGCGACGAAGAC | 145 | 2531–2550 |
| Primer, reverse | CTCTAGCAAGYCTAGTAGAATGCC | 145 | 2675–2652 |
| Probe | AACCCACACCATCCAGGAGCATCTG | 145 | 2646–2622 |
The probe was 5′ end labeled with 6-carboxyfluorescein and 3′ end labeled with eclipse dark quencher.
Nucleotide numbering is based on HBoV2 isolate strain PK-5510 (accession no. NC_012042).