Table 1.
Scedosporium species-specific primer pairs developed and evaluated as part of this study
| Species | Primer name | Primer sequence | Amplicon size (bp) | Primer pairs used in: |
|---|---|---|---|---|
| P. boydii species complex/P. apiosperma | MSAP1 | 5′ AGGCCTGCCGTCAAACCACCTAAC 3′ | 300 | Species-specific single PCR and multiplex PCR |
| MSA2 | 5′ CTACTCGACTCGTCGAAGGAGC 3′ | 300 | Species-specific single PCR and multiplex PCR | |
| P. minutispora | MPMI1 | 5′ CTCTGTTTCGTTAGCGAAAGCTCAG 3′ | 450 | Species-specific single PCR only |
| MSA2 | 5′ CTACTCGACTCGTCGAAGGAGC 3′ | 450 | Species-specific single PCR only | |
| S. aurantiacum | MSAU1 | 5′ TAGCGGATTACAAGCTCTGATTG 3′ | 650 | Species-specific single PCR and multiplex PCR |
| MSA2 | 5′ CTACTCGACTCGTCGAAGGAGC 3′ | 650 | Species-specific single PCR and multiplex PCR | |
| S. dehoogii | MSDE1 | 5′ CGCCCGAAAGGACGACGGC 3′ | 700 | Species-specific single PCR only |
| MSA2 | 5′ CTACTCGACTCGTCGAAGGAGC 3′ | 700 | Species-specific single PCR only | |
| S. prolificans | MSPF1 | 5′ CATTACCGAGTTATTACTCCAAACC 3′ | 180 | Species-specific single PCR and multiplex PCR |
| MSPR2 | 5′ TCCGTTGTTGAAAGTTTTGATTTGT 3′ | 180 | Species-specific single PCR and multiplex PCR |