Table 3.
nodD primers for specific amplification of Rhizobium leguminosarum bv. trifolii and bv. viciae and number of BLAST hits scoring 100% identity and percent identity with top nontarget hit
| Primer name | Target | Primer sequence(s)a | Length (bp) | Tm (°C) | % GC | No. of 100% BLAST hits |
Top nontarget hit, % identity | |
|---|---|---|---|---|---|---|---|---|
| Target | Clones or R. leguminosarum. sp. | |||||||
| nodD trifolii F235 | R. leguminosarum bv. trifolii | CSGATTTCATGACGCTBGTATTC | 22 | 59 | 43 | 9 (total) | 10 | |
| CcGATTTCATGACGCTcGTATTC | 3 | 4 | 91 | |||||
| Degeneracies for nodD trifolii | CgGATTTCATGACGCTcGTATTC | 1 | 78 | |||||
| F235 primer | CgGATTTCATGACGCTtGTATTC | 1 | 1 | 73 | ||||
| CcGATTTCATGACGCTgGTATTC | 2 | 5 | 78 | |||||
| CgGATTTCATGACGCTgGTATTC | 2 | 82 | ||||||
| nodD trifolii R566 | R. leguminosarum bv. trifolii | GCCGCTTAAAACCGTGCTC | 18 | 59 | 58 | 9 | 11 | 89 |
| nodD viciae F88 | R. leguminosarum bv. viciae | TGCAGAGACGGGAGCTARTTC | 21 | 58 | 52 | 85 | 55 | 81 |
| nodD viciae R328 | R. leguminosarum bv. viciae | TCGTCAAGTGGCAGCAACTC | 20 | 59 | 55 | 84 | 62 | 80 |
| nodD viciae F443 | R. leguminosarum bv. viciae | GACGCACACCAGTCTCTCTTCG | 22 | 61 | 59 | 80 | 60 | 77 |
| nodD viciae R662 | R. leguminosarum bv. viciae | GGGGATGGTTGCTATTCGAT | 20 | 57 | 60 | 79 | 46 | 90 |
Lowercase letters indicate site of degeneracy.