Table 2.
Oligonucleotide primers used in this study
| Primer | Sequence (5′–3′)a | Use |
|---|---|---|
| S1 | TTGGAGGTGAATACTGG | With primer S2 to PCR amplify a 205-bp fragment within srpS; used in RT-PCR to amplify the first-strand cDNA of srpS |
| S2 | TCGGTCTGCCTGGCTTCT | With primer S1 or with R0 in RT-PCR to amplify a 940-bp fragment overlapping srpS and srpR |
| R0 | CGCCGATTGAGGTTTGAAG | RT-PCR to amplify the first-strand cDNA of srpR or srpSR; used with primer R2 to amplify a 450-bp fragment within srpR |
| R2 | AGGCGGAGGAGACAAGA | With primer R0 to PCR amplify the cDNA of srpR |
| SP1 | AACCTGTTCTTTCTCACCAC | With AP2, PCR amplification of a 490-bp fragment in the srpS-srpA intergenic region used in EMSAs |
| AP2 | TTCTTCCAGAGCGTTGATGA | With SP1, PCR amplification of a 490-bp fragment in the srpS-srpA intergenic region used in EMSAs |
| SF-01 | ATGTCGACTACAGTGGCGGC | With SR-02, PCR amplification of an 831-bp fragment encompassing the coding sequence of srpS to clone into pMAL-c2X |
| SR-02 | TTAAGCTTCTAGGGAGCTTTCTTC | With SF-01, PCR amplification of an 831-bp fragment encompassing the coding sequence of srpS to clone into pMAL-c2X |
| RF-01 | TAGTCGACATGGCTAGAAAGACG | With RR-02, PCR amplifies a 642-bp fragment encompassing the coding sequence of srpR to clone into pMAL-c2X |
| RR-02 | ATAAGCTTTACTCGAAGGATTTGACTT | With RF-01, amplifies a 642-bp fragment encompassing the coding sequence of srpR to clone into pMAL-c2X |
| SR | ACCACTCTGCCTCACTTCG | RT-PCR to amplify the first-strand cDNA of srpS |
| SF0 | TGCTGAATCGTAATGCGGT | With primer SR to determine the transcription start site of srpS |
| SF1 | CCGTTGGTCGAGGTTTACC | With primer SR to determine the transcription start site of srpS |
| SF2 | CCAGAGCAGCCTCGATCA | With primer SR to determine the transcription start site of srpS |
| AR | CGTGGGTCAATCTGATAAAG | RT-PCR to amplify the first-strand cDNA of srpA |
| AF0 | ATCGCATAATGGTAGACTCT | With primer AR to determine the transcription start site of srpA |
| AF1 | AGACTCTACCGCATTACGAT | With primer AR to determine the transcription start site of srpA |
| AF2 | ATTACGATTCAGCAATAGCC | With primer AR to determine the transcription start site of srpA |
| AR5Sst | AAGAGCTCGATGGTCCGTC | PCR amplification of a 657-bp fragment encompassing the entire coding sequence of arpR to clone into pQE31 |
| AR3Pst | GGCTGCAGCAAAGTGTCAT | |
| S5Bam | AAGGATCCTATGAACCAATCA | PCR amplification of a 794-bp fragment encompassing the entire coding sequence of srpS to clone into pQE31 |
| S3Kpn | CTTATCTAGGGTACCTTCTTCGAC | |
| R5Bam | AAGGATCCATGGCCAGAAAGAC | PCR amplification of a 649-bp fragment encompassing the entire coding sequence of srpR to clone into pGEX-4T-1 |
| R3Eco | GGGAATTCGGATTTGACTTGC |
a
Engineered restriction sites are underlined.