Table 1.
Primer sets used in the study of BE-20 bone sample.
| Primer | Position* | Primer sequence | length (bp)** | Reference |
|---|---|---|---|---|
| mt-U1 | 15412-15432 | CCACCATCAGCACCCAAAGCT | 103 | (Nakamura et al., 2009) |
| dogDL-5 | 15555-15533 | CATTAATGCACGACGTACATAGG | (Leonard et al., 2002) | |
| dL15590MGB | 15568-15590 | CATATAAGCATGTACATAATATT | 99 | (Malmstrom et al., 2005) |
| dH15669R | 15692-15669 | CATGGTGATTAAGCCCTTATTGGA | (Malmstrom et al., 2005) | |
| H15422 | 15404-15422 | CTCTTGCTCCACCATCAGC | 112 | (Boyko et al., 2009) |
| dogDL-5 | 15555-15533 | CATTAATGCACGACGTACATAGG | (Leonard et al., 2002) | |
| dogDL-4 | 15656-15679 | GCATATCACTTAGTCCAATAAGGG | 109 | (Leonard et al., 2002) |
| mt-U2 | 15809-15789 | TGGCCCTGAAGTAAGAACCAG | (Nakamura et al., 2009) |
*
Position based on the reference dog sequence deposited in the UCSC Genome Browser (Kent et al., 2002).
**
The expected length of the amplicon after the removal of the primer sequence. The actual sequence data may differ because of insertion/deletion polymorphisms and sequence quality.