Skip to main content
. 2011 Apr 21;62(11):3765–3779. doi: 10.1093/jxb/err051

Table 3.

Expression pattern consistent miRNA tags in microarray profiling and high-throughput sequencing under drought stress

Tag name Sequence (5'–3') Microarray
High-throughput sequencing
Group C median signal Control median signal log2 (Group C/control) Control expressed Group C expressed Control normalized Group C normalized log2 (Group C/control)
ath-miR156g CGACAGAAGAGAGUGAGCAC 6106.99 4801.66 0.35 106. 72 22.07 40.18 0.86
ath-miR319a UUGGACUGAAGGGAGCUCCCU 9658.96 6994.93 0.41 19 35 3.96 19.53 2.30
bna-miR156a UGACAGAAGAGAGUGAGCACA 4760.84 3484.23 0.47 7229 9584 1505.19 5348.95 1.83
ghr-miR156c UGUCAGAAGAGAGUGAGCAC 4302.29 3028.75 0.59 15 23 3.12 12.84 2.04
peu-miR102 UCUUUCCGAGUCCUCCCAUACC 3937.86 3270.72 0.27 73 72 15.20 40.18 1.40
peu-miR102* UAUGGGAGAGGCGGGAAUGACU 665.89 310.08 1.10 8 15 1.67 8.37 2.33
peu-miR123a UGUCGCAGGAGAGAUGGCGCU 302.07 109.51 1.59 515 387 107.23 215.99 1.01
peu-miR123b UGUCGCAGGAGAGAUGGCGCUA 263.11 88.76 1.60 588 344 122.43 191.99 0.65
peu-miR129 UUCAUUCCUCUUCCUAAAAUGG 248.30 64.90 1.88 89 87 18.53 48.56 1.39
pta-miR319 UUGGACUGAAGGGAGCUCC 8945.88 6395.55 0.49 4 12 1.00 6.70 2.74
ptc-miR156a UGACAGAAGAGAGUGAGCAC 6205.64 4932.89 0.41 122451 109321 25496.16 61013.36 1.26
ptc-miR156k UGACAGAAGAGAGGGAGCAC 3549.59 2359.96 0.68 439 248 91.41 138.41 0.60
ptc-miR162a UCGAUAAACCUCUGCAUCCAG 9416.06 6869.24 0.45 3671 1859 764.36 1037.53 0.44
ptc-miR167f UGAAGCUGCCAGCAUGAUCUU 8097.06 6035.68 0.41 3202 1616 666.71 901.91 0.44
ptc-miR319a UUGGACUGAAGGGAGCUCCC 12057.19 10260.72 0.23 67 183 13.95 102.13 2.87
ptc-miR396a UUCCACAGCUUUCUUGAACUG 4357.86 1427.49 1.68 186 352 38.73 196.46 2.34
ptc-miR396c UUCCACAGCUUUCUUGAACUU 542.90 83.90 2.66 92 110 19.16 61.39 1.68
ptc-miR473a ACUCUCCCUCAAGGCUUCCA 2335.32 1671.64 0.52 1153 2216 240.07 1236.78 2.37
sbi-miR156e UGACAGAAGAGAGCGAGCAC 4269.41 3034.67 0.53 118 81 24.57 45.21 0.88
vvi-miR156e UGACAGAGGAGAGUGAGCAC 3387.98 2394.35 0.51 52 47 10.83 26.23 1.28
vvi-miR167c UGAAGCUGCCAGCAUGAUCUC 4819.80 2951.66 0.77 27 23 5.62 12.84 1.19
ptc-miR166n UCGGACCAGGCUUCAUUCCUU 2540.95 4532.28 –0.89 799 33 166.36 18.42 –3.18
ptc-miR169z CAGCCAAGAAUGAUUUGCCGG 8.87 69.20 –2.96 320 59 66.63 32.93 –1.02

‘Group C/control median signal’, the median signal for each of the three miRNA tags probe in the microarray. ‘Group C/control expressed’, the high-throughput sequencing reads for each miRNA tags; ‘Group C/control normalized’, the normalized miRNA tag expression in tags per million; ‘log2 (GroupC/control)’, log2 ratio of the median signal in the microarray or the normalized expression in the high-throughput sequencing between drought treatment (Group C) and control samples.