Table 2. Novel type three effectors.
| hop name | Genbank accession | source strain | hrp box | BLASTp 10−5 cutoff | Strains containing |
| hopAY1 | HM641785 | Pmo | ggaactttttcttgcccgctaccac | Cysteine protease | Pmp, Pan, Pae, Pmo, Pph |
| hopAZ1 | HM641786 | Pan | ggaaccgcttttcaactgattgccac | Hypothetical (Pseudomonas) | Pan, Pma, Ptt, Cit7, Pla 107, Pta, Pae, Pmo, Pgy |
| hopBA1 | HM641787 | Ptt | ggaactgacaagccagtatgagccac | Hypothetical (Erwinia) | Ptt, Pja |
| hopBB1 | HM641788 | Pmo | ggaacttcaatagggtgtcgtaccac | C-terminus similar to hopF2 | Pmp, Pae |
| hopBC1 | HM641789 | Ptt | ggaaccgtcttcgggacacggccac | Hypothetical (Erwinia) | Ptt, Pja, Pac |
| hopBD1 | HM641790 | Pla 107 | ggaaccgatcgaggggttctgaccac | Hypothetical (Acidovorax) | Pla 106, Pma, Pla 107, Pmo |
| hopBE1 | HM641791 | Pac | ggaacccgatccatccgccgagccac | Hypothetical (Burkholderia) | Pac |
| hopBF1 | HM641792 | Ptt | ggaacccaactcactcaattcatcac | Hypothetical (Acidovorax) | Por, Ptt |
| hopBG1 | HM641793 | Pma | ggaaccgaatccatctcgagggccac | Hypotheical (Bradyrhizobium) | Pma |
The characteristics of representative alleles for each new hop are listed. During analysis of this data, another group identified HopAY1 [96]. We include this TTE family in the table but not when describing the total number of TTE families discovered. BLASTp 10−5 cutoff column indicates the best hit for each allele in the NCBI NR database. The strains containing column indicates which of the sequence strains also contain alleles of these hop families. The translocation of representative alleles was verified, but consult Dataset S9 for translocation data for alleles from other genomes.