Table 2. Primers used for the amplification and sequencing of the seven loci evaluated for the B. bacilliformis MLST scheme.
locus | putative gene product | product size (bp) | position1 | forward primer (5′-3′) | reverse primer (5′–3′) | reference |
bvrR | regulatory protein | 486 | 1385452–1385937 | GACCGCAATATTTTGACATC | GCATCCATCAAAGCATCACGACTT | [16] |
ribC | riboflavin synthase alpha subunit | 349 | 652816–653164 | GATATCGGTTGTGTTGAAGA | AAAGGCGCTAACTGTTC | [20] |
ftsZ | cell division protein | 497 | 969686–970182 | CTCAAGTAGGAGTGCTGCTA | CCAATTGATCTTCCTCGTTTAC | this study |
groEL | heat shock protein | 442 | 1211811–1212252 | CAACAGAAGTTGAAGTGAAAG | TAGAAATCCATTCCGCCCATT | this study |
flaA | flagellin A | 517 | 1076953–1077409 | TTCACTGAAGCTGCTGATAAA | CTTGTATTTGTAACGTCGTA | this study |
rnpB | RNA subunit of endoribonuclease RNase P | 297 | 988378–988674 | CGGGATCCGGGGAGGAAAGTCCGGGC | CGGAATTCRTAAGCCGGRTTCTGT | [21] |
rpoB | RNA polymerase beta subunit | 363 | 579639–580001 | ACGCCTGAAGGTCCAAATAT | CTTCAGAACGGATCAATGGA | this study |
Corresponding to the complete genome sequence of B. bacilliformis strain KC583 Genbank accession number CP000524.