Skip to main content
. 2011 Jul 19;5(7):e1248. doi: 10.1371/journal.pntd.0001248

Table 2. Primers used for the amplification and sequencing of the seven loci evaluated for the B. bacilliformis MLST scheme.

locus putative gene product product size (bp) position1 forward primer (5′-3′) reverse primer (5′–3′) reference
bvrR regulatory protein 486 1385452–1385937 GACCGCAATATTTTGACATC GCATCCATCAAAGCATCACGACTT [16]
ribC riboflavin synthase alpha subunit 349 652816–653164 GATATCGGTTGTGTTGAAGA AAAGGCGCTAACTGTTC [20]
ftsZ cell division protein 497 969686–970182 CTCAAGTAGGAGTGCTGCTA CCAATTGATCTTCCTCGTTTAC this study
groEL heat shock protein 442 1211811–1212252 CAACAGAAGTTGAAGTGAAAG TAGAAATCCATTCCGCCCATT this study
flaA flagellin A 517 1076953–1077409 TTCACTGAAGCTGCTGATAAA CTTGTATTTGTAACGTCGTA this study
rnpB RNA subunit of endoribonuclease RNase P 297 988378–988674 CGGGATCCGGGGAGGAAAGTCCGGGC CGGAATTCRTAAGCCGGRTTCTGT [21]
rpoB RNA polymerase beta subunit 363 579639–580001 ACGCCTGAAGGTCCAAATAT CTTCAGAACGGATCAATGGA this study
1

Corresponding to the complete genome sequence of B. bacilliformis strain KC583 Genbank accession number CP000524.