Skip to main content
. 2011 Jul 1;108(2):367–380. doi: 10.1093/aob/mcr141

Table 2.

Primers used for amplification and sequencing of the four chloroplast intergenic spacer regions

Region/primer Sequence (5'-3') Use Reference
psbD-trnT
 psbD-F TCAACTACTTCAACCATTTCC Amplification/sequencing Ye Tun Tun and Yamaguchi (2008)
 trnT-R TGGTAAGGCGTAAGTCATCG Amplification/sequencing Ye Tun Tun and Yamaguchi (2008)
 DT-F2 TGGTGGAACTTGAAATTGGT Sequencing Ye Tun Tun and Yamaguchi (2008)
 DT-R2 ACCAATTTCAAGTTCCACCA Sequencing Ye Tun Tun and Yamaguchi (2008)
trnT-trnE
 trnT-F CGATGACTTACGCCTTACC Amplification/sequencing Ye Tun Tun and Yamaguchi (2008)
 trnE-R AGAGAGATGTCCTGAACCAC Amplification/sequencing Ye Tun Tun and Yamaguchi (2008)
petA-psbJ
 petA-F GTTACGTGTCCAAGGTCTC Amplification/sequencing This study
 psbJ-R CCGATACTACTGGAAGGATT Amplification/sequencing This study
trnT-trnL
 trn-a CATTACAAATGCGATGCTCT Amplification/sequencing Taberlet et al. (1991)
 trn-b TCTACCGATTTCGCCATATC Amplification/sequencing Taberlet et al. (1991)