Skip to main content
. 2011 Aug;77(15):5132–5140. doi: 10.1128/AEM.05008-11

Table 1.

Bacterial strains, plasmids, and primers

Strain, plasmid, or primer Relevant characteristics Reference or source
Strains
    LY180 ΔfrdBC::(Zm frg celYEc) ΔldhA::(Zmfrg casA BKo) adhE::(ZmfrgestZPp FRT) ΔackA::FRT rrlE::(pdc adhA adhB FRT) ΔmgsA::FRT 30
    EM322 LY180 ΔyqhD::FRT 30
    BL21(λDE3) FompT gal dcm lon hsdSB(rBmB) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) Promega, Madison, WI
    MM160 Hydrolysate-resistant derivative of LY180, yqhD frameshift 13
    XW042 MM160 ldhA::ldhL Δ(rrlE::[pdc adhA adhB FRT]), Δ(Zm frg estZPp FRT) l-lactate production This study
    XW043 MM160 ldhA restored, Δ(rrlE::[pdc adhA adhB FRT]), Δ(Zm frg estZ Pp FRT) d-lactate production This study
    XW059 XW042 after serial transfer with xylose l-lactate production This study
    XW068 XW043 after serial transfer with xylose d-lactate production This study
Plasmids
        pTrc99A pTrc bla oriR rrnB lacIq 4
        pCR2.1 TOPO cloning vector Invitrogen
        pLOI4162 PacI-flanked cat-sacB cassette 17
        pET15b T7 expression vector Novagen
    fucO cloning and expression
        pLOI4319 fucO in pTrc99A This study
        pLOI4322 fucO in pET15b This study
    Deletion of (rrlE::[pdc adhA adhB FRT])
        pLOI4780 pdc-adhA-adhB from LY180 cloned into pCR2.1-TOPO vector This study
        pLOI4781 cat-sacB cassette cloned into pdc-adhA-adhB in pLOI4780 This study
        pLOI4782 PacI digestion of pLOI4781; self-ligated to delete pdc-adhA-adhB This study
    Deletion of (adhE::[Zm frg estZPp FRT])
        pLOI4811 adhE::(Zm frg estZPp FRT) region cloned into pCR2.1-TOPO vector This study
        pLOI4824 cat-sacB cassette cloned into the adhE::(Zm frg estZPpFRT) region of pLOI4811 This study
        pLOI5167 E. coli adhE ORF and its adjacent regions cloned into pCR2.1 TOPO vector This study
        pLOI5168 cat-sacB cassette cloned into adhE in pLOI5167 This study
        pLOI5169 PacI digestion of pLOI5168; self-ligated to delete adhE This study
    ldhA restoring
        pLOI4652 ldhA (PCR) from E. coli cloned into the pCR2.1-TOPO vector 41
        pLOI4653 cat-sacB cassette cloned into ldhA of pLOI4652 41
    ldhL integration
        pLOI5161 ldhA ORF and its adjacent regions cloned into pCR2.1 TOPO vector This study
        pLOI5174 ldhL ORF from TG108 was cloned and used to replace the ldhA ORF in pLOI5161 This study
Primers
    fucO cloning
        fucO for EcoRI CGCGCGGAATTCGATTGCCGTAGTGCTGGAGA This study
        fucO rev BamHI CGCGCGGGATCCTGCGGTTGGTACGGTAACGG This study
    ldhA and ldhL integration
        ldhA for GATAACGGAGATCGGGAATG (for construction of pLOI4652) 41
        ldhA rev CTTTGGCTGTCAGTTCACCA (for construction of pLOI4652) 41
        ldhA-1 TCTGGAAAAAGGCGAAACCT (for construction of pLOI4653) 41
        ldhA-2 TTTGTGCTATAAACGGCGAGT (for construction of pLOI4653) 41
        ldhL ORF up ATGTCTAATATTCAAAATCATCAAAAAGTTGTCCTCGTCG (for construction of pLOI5174) This study
        ldhL ORF down TTATTTGTCTTGTTTTTCAGCAAGAGCGTTTAGAC (for construction of pLOI5174) This study
        ldhA rev1 AAGACTTTCTCCAGTGATGTTGAATCAC (for construction of pLOI 5174) This study
        ldhA for1 TCTTGCCGCTCCCCT (for construction of pLOI5174) This study
    Deletion of (rrlE::[pdc adhA adhB FRT])
        pdc for TGGTCTCAAGCATCACTTCG This study
        adhB rev TTGGTCAGAGCACAAGCATC This study
        adhB-1 CCCACGCATTTGAAGCTTAT This study
        pdc-2 ATCGATTTTAGCCGGAGCTT This study
    Deletion of (Zm frg estZPp FRT)
        estZ for ACTGGCATCTGAGTTCTCTG This study
        estZ rev TTCCATGGCGTGAGTTACTG This study
        estZ-1 CAGACCGTGCGGAATATGGA This study
        estZ-2 CAGCCTCGATTCGCATGACA This study
        adhE for CAATACGCCTTTTGACAGCA This study
        adhE rev GCCATCAATGGCAAAAAGTT This study
        adhE-1 TCAGTAGCGCTGTCTGGCA This study
        adhE-2 AATGCTCTCCTGATAATGTTAAACTTTTTTAGTA This study
    Amplification and sequencing of yqhD region
        yqhD for TATGATGCCAGGCTCGTACA This study
        yqhD rev GATCATGCCTTTCCATGCTT This study