Fig. 2.

Identification of the site required for CviR binding to the vioA promoter. (A) Schematic of the vioA promoter. Numbers indicate the base position with respect to the transcription start site; deletions are shown below the sequence. The region required for activation by CviR is underlined. (B) Production of GFP in response to 1 μM C₁₀-HSL for the constructs shown in panel A was measured in E. coli expressing CviR and harboring the vioA-gfp plasmid. (C) CviR:C₁₀-HSL electrophoretic mobility shift assay on a double-stranded oligonucleotide (CCGCCCTGACCCTTGGAACAGTATCC) containing the sequence shown to be required for activation by CviR in panel B. Numbers below the gel indicate the concentration of CviR:C₁₀-HSL in each binding reaction mixture.