Table 1.
Candidate reference and differentially expressed genes with putative function and gene ID from the Dappu V1.1 draft genome annotation, primer sequences, amplicon characteristics.
| Gene symbol | Gene name | (putative) Function | Gene ID | P | Primer sequences [5'→3'] | L (bp) | Localization in gene | E (%) |
|---|---|---|---|---|---|---|---|---|
| aTub | alpha Tubulin | Cytoskeletal protein | Dappu-301837 | 5 | GCATGTTGTCCAACACTACTGC | 135 | 3' exon | 91 |
| CCTCAGAGAACTCTCCCTCCTC | ||||||||
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | Glycolytic enzyme | Dappu-302823 | 0 | TGGGATGAGTCACTGGCATAC | 136 | 3' exon | 93 |
| GAAAGGACGACCAACAACAAAC | ||||||||
| Tbp | TATA binding protein | Transcription initiation | Dappu-194512 | 0 | CTACGATGCATTCGATAACATATACC | 144 | 3' exon | 90 |
| AGAACCAGCAATGAGTTAAACAAAG | ||||||||
| Stx16 | Syntaxin 16 | Protein involved in exocytosis | Dappu-194044 | 0 | CACATTGGTCGTCCTTAGTCTTG | 148 | 3' exon | 93 |
| TGCTATACGTTACGCTTGTCCTTAC | ||||||||
| Xbp1 | X-box binding protein 1 | Transcription factor | Dappu-314438 | 0 | CCGATATTCGAGACTGCAATG | 131 | 3' exon | 93 |
| AAAGATGGGTGAGCCAGAAATAC | ||||||||
| MMP | Matrix metallo-proteinase | Degradation of extracellular proteins | Dappu-303491 | 0 | CGAAACATGGACGCATAACTC | 80 | spanning penultimate 3' intron | 92 |
| GTCCCAAAGTGTGACCGAAC | ||||||||
| CAPON | C-terminal pdz ligand of neuronal nitric oxide synthase | Location of neuronal nitric oxide synthase | Dappu-100564 | 0 | TAACGAGTCGGGAGGAAGTG | 140 | 3' exon | 94 |
| GCTGGACTTGAGCCAGTATCTC |
Abbreviations: E: amplification efficiency; P: number of paralogs in D. pulex genome; L: length of the amplicon